Схема размножения хламидомонады: Изучение полового и бесполого размножения хламидомонады

Половое размножение растений. Способы размножения

Вопросы и задания

Вопрос 1. Какие способы размножения встречаются у растений?

Растения размножаются как бесполым, так и половым способом.

Вопрос 2. Рассмотрите рисунок на с. 139. Что общего и в чём разница в половом размножении хламидомонады и спирогиры?

Общим в половом размножении хламидомонады и спирогиры можно считать образование зиготы, имеющей двойной набор хромосом, которая покрывается плотной оболочкой и в таком состоянии переживает зиму. С наступлением тепла её содержимое делится.

Отличием можно считать:

1. Процессы предшествующие образованию зиготы:

При половом размножении хламидомонады под оболочкой материнской клетки развивается много мелких двухжгутиковых гамет (от 32 до 64 клеток). Прорвав оболочку, они выходят наружу, где попарно сливаются с гаметами других особей, образуя зиготы.

Осенью две параллельно расположенные нити спирогиры обволакиваются слизью. В клетках, находящихся одна напротив другой, образуются выросты — мостики, оболочки на концах выростов растворяются. Содержимое одной клетки перетекает в другую, их ядра сливаются — происходит оплодотворение.

2. Процессы, происходящие после образования зиготы:

С наступлением тепла содержимое зиготы хламидомонады делится путём мейоза, образуя четыре хламидомонады. Они выходят наружу и начинают вести самостоятельный образ жизни.

Переждав неблагоприятные условия, ядро зиготы спирогиры дважды делится, три ядра из четырёх отмирают, а одноядерная клетка прорастает в новую нить спирогиры.

Вопрос 3. Почему для полового размножения мхов и папоротников нужна вода, а для цветковых растений — нет?

Мхи и папоротники не образуют пыльцу, надежно защищенную от высыхания. Их мужские половые клетки, спермии, добираются до яйцеклеток вплавь, а на воздухе неподвижны и беззащитны.

Много воды для оплодотворения не требуется. Мхам, например, достаточно тонкой пленки, образованной каплями росы или дождя, но в сухую погоду у них могут возникнуть проблемы с размножением, особенно если мужские и женские растения удалены друг от друга. В этих условиях перенос спермиев могут обеспечить только животные.

Вопрос 4. Чем оплодотворение у цветковых растений отличается от подобного процесса у других организмов?

У цветковых растений в оплодотворении участвуют два спермия, поэтому оплодотворение у них называют двойным. Один из спермиев сливается с яйцеклеткой, образуя зиготу, а второй — с ядром центральной клетки, составляющей большую часть зародышевого мешка.

Вопрос 5. Составьте схему двойного оплодотворения, которая отражала бы суть процесса. Почему оплодотворение называют двойным?

У цветковых растений в оплодотворении участвуют два спермия, поэтому оплодотворение у них называют двойным.

Схема двойного оплодотворения

Вопрос 6. Каково биологическое значение двойного оплодотворения?

Несомненное его преимущество очень быстрое (опережающее развитие зародыша) образование питательной ткани, которое происходит только после оплодотворения. Двойное оплодотворение ускоряет весь процесс формирования семяпочки и семени.

Вопрос 7. Какова роль опыления в размножении?

Опыление — перенос пыльцы с тычинок на рыльце пестика. В противном случае гаметы не встретятся и оплодотворения не произойдет.

Вопрос 8. Сравните понятия «перекрёстное опыление» и «самоопыление».

При самоопылении пыльца попадает с тычинки на пестик того же самого цветка. Пшеница, рис, овёс, горох — самоопыляющиеся растения.

При перекрёстном опылении пыльца с тычинок цветка переносится на рыльце пестика цветка другого растения. Различают насекомоопыляемые и ветроопыляемые растения. Насекомоопыляемые растения имеют красивые, яркие цветки или мелкие цветки, собранные в соцветия. Обычно они богаты нектаром, пыльцой, обладают приятным запахом. У ветроопыляемых растений мелкие, невзрачные цветки, собранные в соцветия. Пыльца у них сухая, мелкая, лёгкая. Ветром опыляются тополь, ольха, дуб, рожь.

Одноклеточные водоросли — Биология. 6 класс. Костиков

Биология. 6 класс. Костиков

Речь пойдёт об организмах, питающихся как растения, но состоящих только из одной клетки.

Что представляют собой споры? Чем отличаются сине-зелёные водоросли от зелёных?

Эвглена. Среди одноклеточных фотосинтезирующих эукариот эвглена наиболее похожа на одноклеточные животноподобные организмы. Клетки эвглены одиночные и подвижные. В процессе движения эвглены могут изменять форму — вытягиваться, сокращаться, изгибаться.

В центре клетки находится большое хорошо заметное ядро (рис. 46). В цитоплазме также чётко различается от одного до нескольких зелёных хлоропластов: с их помощью на свету эвглена осуществляет фотосинтез. В темноте эвглена способна переходить к гетеротрофному питанию, поглощая всей поверхностью клетки растворённые в воде органические вещества.

Рис. 46. Строение клетки эвглены

Движение происходит при помощи длинного жгутика, который выходит из углубления — глотки. В глотке у эвглены находится ещё один, утолщённый при основе, короткий жгутик, который, в отличие от длинного, не выходит наружу. Возле этого жгутика в цитоплазме расположен большой красный глазок. Вместе со жгутиковым утолщением глазок образует систему, благодаря которой эвглена определяет направление падения света и выбирает маршрут своего движения.

К глотке прилегает несколько сократительных вакуолей, выделяющих в неё лишнюю воду, постоянно поступающую в клетку через мягкий клеточный покров. Таким образом, глотка не только не принимает участия в питании, а наоборот, осуществляет функцию выделения, поскольку с водой при помощи сократительных вакуолей клетка освобождается от вредных продуктов жизнедеятельности.

Размножается эвглена продольным делением клетки пополам в подвижном состоянии.

Эвглены живут в пресных стоячих или слабо проточных водоёмах. Потребляя растворённые органические вещества, эвглены вместе с другими одноклеточными эукариотами участвуют в процессах самоочищения воды.

Хламидомонада принадлежит к зелёным водорослям. Наличием жгутиков и зелёного хлоропласта она напоминает эвглену. Однако наличие клеточной оболочки, обеспечивающей постоянную форму клетки, делает хламидомонаду похожей на растительную клетку (рис. 47).

Рис. 47. Строение клетки хламидомонады под оптическим микроскопом

Большую часть цитоплазмы занимает зелёный хлоропласт, на дне которого вокруг большого округлого тельца откладывается запасной углевод — крахмал. Он образуется из глюкозы, вырабатываемой хлоропластом в процессе фотосинтеза. В хлоропласте хорошо различается небольшое красное пятнышко — это глазок. Он помогает клетке определять направление падения света и, как следствие, выбирать «маршрут» движения. Под электронным микроскопом в клетке хламидомонады можно различить и другие характерные для эукариот органеллы.

Хламидомонада чаще всего размножается при помощи подвижных спор (рис. 48). Они возникают вследствие деления материнской клетки. Клеточная оболочка в этих делениях не участвует. После разрыва оболочки материнской клетки споры освобождаются, и каждая становится самостоятельным организмом.

Размножение подвижными спорами является одним из примеров бесполого размножения.

Бесполое размножение — это размножение, происходящее без полового процесса, а значит, без обмена наследственной информацией между клетками. Специализированные клетки бесполого размножения — это споры.

При неблагоприятных условиях окружающей среды у хламидомонады происходит половой процесс (рис. 48). Мужская и женская патовые клетки у хламидомонады возникают так же, как и споры, и внешним видом между собой не отличаются. Перед слиянием они сбрасывают клеточные оболочки и соединяются передними частями. Затем их цитоплазмы сливаются. Далее сливаются ядра, и в результате образуется клетка, называемая зиготой. Она покрывается толстой оболочкой и в таком состоянии переживает неблагоприятные условия. В период покоя в зиготе происходит обмен участками ДНК мужской и женской клеток. По завершении периода покоя зигота делится и образует четыре новые клетки.

Зигота — это клетка, образовавшаяся в результате слияния цитоплазм и ядер мужской и женской половых клеток.

Рис. 48. Схема бесполого (красные стрелки) и полового (синие стрелки) размножения хламидомонады

Половое размножение — это размножение, при котором количество особей одного вида увеличивается вследствие полового процесса, который, в свою очередь, обеспечивает обмен наследственной информацией между родительскими клетками.

Летом хламидомонады в большом количестве можно найти практически в каждой луже.

Хлорелла также является примером одноклеточных зелёных, но уже неподвижных водорослей. Она живёт преимущественно в наземных условиях: во влажной почве, сырых стенах, а также как симбионт в теле водных организмов.

Клетки хлореллы одиночные, шарообразные, с тонкой, но очень прочной клеточной оболочкой. Благодаря клеточной оболочке хлореллы, ставшие добычей почвенных животных, проходят неповреждёнными через пищеварительную систему и далее продолжают успешно расти и размножаться. В каждой клетке имеется один большой зелёный хлоропласт, в котором откладывается крахмал (рис. 49). Размножение хлореллы происходит исключительно бесполым путём: с помощью неподвижных спор.

Рис. 49. Хлорелла: а — схема размножения; б — клетка под электронным микроскопом; 1 — хлоропласт; 2 — крахмал

Хлорелла неоднократно побывала в космосе — на ней изучалось влияние невесомости на процессы клеточного деления. Во многих странах хлореллу на специальных фабриках искусственно выращивают для получения витаминов и производства пищевых добавок, и при этом «кормят» её углекислым газом промышленных выбросов предприятии, осуществляя тем самым биологическую очистку воздуха.

Диатомовые водоросли — это большая группа одноклеточных пресноводных и морских водорослей, хлоропласты которых имеют коричневую окраску. Клетки диатомовых водорослей всю свою жизнь проводят в «стеклянном доме» — кремнезёмном панцире. Панцирь напоминает коробку, накрытую крышкой. Через его многочисленные правильно расположенные отверстия осуществляются все процессы обмена со внешней средой — поглощение воды и углекислого газа, выделение кислорода и прочих продуктов жизнедеятельности. Размножаются диатомовые водоросли продольным делением клетки пополам. Также им присущ и половой процесс.

В пресных водоёмах самой распространённой диатомовой водорослью является навикула (рис. 50). Её клетки напоминают лодочку, вдоль бортов которой лежат две коричневые трубки — хлоропласты. В центре находится ядро. Клетки навикулы способны активно скользить по подводным поверхностям, выделяя через специальную структуру панциря — шов — особые слизистые ножки.

Рис. 50. Диатомовая водоросль навикула: а — схема строения: 1 — вакуоль, 2 — ядро, 3 — хлоропласт, 4 — кремнезёмный панцирь, 5 — система, обеспечивающая движение — шов; б — клетка под оптическим микроскопом

Наиболее часто диатомовые водоросли используются геологами и работниками служб охраны природы для оценки степени загрязнения вод и определения возраста осадочных пород. В хозяйственной деятельности широкое применение имеют породы диатомиты, образованные панцирями ископаемых диатомовых водорослей.

ВЫВОДЫ

  • 1. Одноклеточные эукариоты, способные к фотосинтезу, относятся к водорослям.
  • 2. Одноклеточные водоросли различаются цветом, строением клеток, подвижностью, способами размножения.

ТЕРМИНЫ И ПОНЯТИЯ, КОТОРЫЕ ВАЖНО ЗНАТЬ

Бесполое размножение, спора, зигота, половое размножение.

КОНТРОЛЬНЫЕ ВОПРОСЫ

  • 1. Какой способ питания характерен для эвглены, хламидомонада и хлореллы?
  • 2. Какие способы размножения присущи одноклеточным водорослям?
  • 3. Какие одноклеточные водоросли являются подвижными, а какие — самостоятельно двигаться не могут?

ЗАДАНИЯ

Заполните таблицу в тетради, поставив напротив указанного признака «да» или «нет» в столбиках, относящихся соответствующем организмам.

Признак

Эвглена

Хламидомонада

Хлорелла

1

Имеет хлоропласты

2

Имеет глотку

3

Активно двигается

4

Имеет жгутики

5

Является автотрофом

6

Питается благодаря фагоцитозу

7

Имеет ядро

ДЛЯ ЛЮБОЗНАТЕЛЬНЫХ

Как у эукариот возник фотосинтез?

Фотосинтез с выделением кислорода «изобрели» цианопрокариоты. Первые эукариоты — одноклеточные животноподобные организмы — изобрели фагоцитоз и начали съедать всех, в том числе и цианопрокариот. Но некоторые из них, съев цианопрокариот, не переварили их, а стали использовать как внутриклеточных симбионтов. Они заставили их кормить себя, позднее превратив в хлоропласт (рис. 51). Ближайшие потомки этих «хитрецов» — зелёные и красные водоросли.

Однако и сами «хитрецы» неединократно становились пленниками других одноклеточных животноподобных организмов.

Рис. 51. Схема образования хлоропласта из внутриклеточного симбионта

ГДЗ к учебнику можно найти тут. 

Размножение одноклеточных водорослей — КиберПедия

Для некоторых одноклеточных водорослей, например, хлореллы, характерно только бесполое размножение.

 

Обычно же водоросли размножаются как бесполым, так и половым путём. Способы полового размножения у водорослей очень разнообразны. Рассмотрим размножение одноклеточных водорослей на примере хламидомонады.

 

При благоприятных условиях хламидомонада размножается бесполым способом. Перед делением она перестаёт двигаться и теряет жгутики. В материнской клетке в результате деления образуются 2, 4 или 8подвижных клеток — зооспор. Зооспоры покидают материнскую клетку и вырастают до размеров взрослой хламидомонады.

 


Половым путём хламидомонада размножается при наступлении неблагоприятных условий (похолодание, пересыхание водоёма). В этом случае внутри хламидомонады возникают половые клетки — гаметы. Гаметы разных хламидомонад выходят в воду и соединяются попарно, образуя зиготу, которая покрывается толстой оболочкой. С наступлением благоприятных условий зигота делится, образуя четыре клетки — молодые хламидомонады.


Размножение многоклеточных водорослей

Размножение многоклеточных водорослей рассмотрим на примере улотрикса. Как и другие многоклеточные водоросли, улотрикс размножается бесполым и половым путями.

В благоприятное время размножение идёт бесполым путём. Каждая клетка, кроме той, с помощью которой нить прикрепляется, может разделиться на 2 или 4 подвижные клетки со жгутиками — зооспоры. Они выходят в воду, плавают, прикрепляются к какому-либо подводному предмету и делятся. Так образуются новые нити водоросли.

 

При неблагоприятных условиях в некоторых клетках водоросли образуются многочисленные мелкие подвижные гаметы со жгутиками. В воде они попарно сливаются, образуя зиготу. Обычно сливаются гаметы, возникшие в клетках нитей разных водорослей. Зигота покрывается толстой оболочкой и может долго находиться в состоянии покоя. При наступлении благоприятных условий зигота делится на 4 клетки — безжгутиковые споры. Каждая из них, опустившись на подводный предмет, может дать начало новой нитчатой водоросли улотриксу.

 

 

Многоклеточные водоросли могут размножаться и вегетативнокусочками слоевища.

Размножение мхов

У мхов чётко выражено чередование бесполого и полового поколений.


Бесполое размножение происходит с помощью спор (1). Из проросшей споры образуется тонкая зелёная нить — предросток (2–3), который выглядит как тонкая зелёная ветвящаяся нить. На этой нити образуются почки (4), из которых затем вырастают мужские (7) или женские (8) экземпляры мха.


Половое размножение рассмотрим на примере мха кукушкин лён.
У кукушкина льна есть женские и мужские растения. На мужских растениях развиваются мужские гаметысперматозоиды, на женских растениях формируются женские гаметыяйцеклетки. Во время дождя или во время половодья сперматозоиды по воде подплывают к яйцеклеткам (9).

Обрати внимание!

Оплодотворение невозможно без воды!

При слиянии гамет образуется зигота, которая, не выходя из женского органа, начинает делиться. Из зиготы на женском растении развивается покрытая колпачком коробочка на ножке — спорангий (10). В спорангии образуются споры. В сухую погоду колпачок сбрасывается, споры рассеиваются (1) и прорастают в предростки (2–3), вновь дающие начало новым мужским (7) и женским (8) растениям кукушкина льна.

Таким образом, у мха кукушкин лён в течение жизни происходит смена поколений — бесполого и полового (спорофита и гаметофита).

Гаметофит (половое поколение) представлен облиственным побегом.

Спорофит (бесполое поколение) — коробочка на длинной ножке. Растения бесполого поколения живут за счёт растений полового поколения.

 

При вегетативном размножении у многих мхов формируются подушковидные дернины и сплошным ковром покрывают влажную почву.

Размножение папоротников

У папоротников, так же как и у мхов, чётко представлено чередование полового и бесполого поколений.


 

Летом на нижней стороне папоротника образуются маленькие бурые бугорки. В бугорках находятся пучки мелких мешочков — спорангиев, в которых созревают споры.

Созревшие споры выпадают из спорангиев. Их разносит ветер. Если они попадают в благоприятные условия, то прорастают, образуя заросток (половое поколение — гаметофит). Он живёт самостоятельно, прикрепляясь к почве ризоидами.
На нижней стороне заростка развиваются мужские и женские гаметы (сперматозоиды и яйцеклетки). Под заростком задерживаются капельки росы или дождевой воды, в которых сперматозоиды могут подплыть к яйцеклеткам. Происходит оплодотворение.

Обрати внимание!

Оплодотворение невозможно без воды!

Из зиготы развивается зародыш, который сначала получает питательные вещества от зелёного заростка. Он растёт, и постепенно развивается корень и очень короткий стебель с первым листом. Со временем из зародыша на заростке развивается взрослое растение, которое мы обычно называем папоротником. Это бесполое поколение — спорофит.

В процессе жизни папоротника происходит смена двух поколений — спорофита и гаметофита.

Взрослое растение папоротника, образующее споры, — это спорофит (бесполое поколение).

Заросток папоротника — это гаметофит (половое поколение).

Многие папоротники хорошо размножаются вегетативно, например, с помощью корневища или выводковых почек.

Так же происходит размножение у хвощей и плаунов.

Модель-аппликация Размножение одноклеточной водоросли

1. Назначение пособия

Пособие предназначено для использования в качестве демонстрационного материала в средней общеобразовательной школе в по разделу ‘Растения’. Также данное пособие можно использовать в ВУЗах, на занятиях по ботанике. Модель предназначена для изучения цикла развития одноклеточной водоросли хламидомонады.

2. Устройство пособия и комплектация

Пособие включает в себя 9 карточек (№ П1-П9), на которых изображены стадии деления одноклеточной водоросли. Из карточек монтируются две схемы: бесполое и половое размножение.

Все карточки покрыты матовой антибликовой ламинирующей пленкой и снабжены магнитным креплением, позволяющим монтировать приведенную ниже схему на магнитной доске или экране.

3. Методика работы с моделью

Карточки располагаются на доске кругом по часовой стрелке, как это указано на монтажной схеме. Стрелки между карточки рисуются на доске мелом. По ходу монтирования модели учитель объясняет учащимся теорию. Также модель можно использовать для контроля знаний. На первой схеме изображено бесполое размножение одноклеточной водоросли:

Монтаж схемы №1 (Бесполое размножение)

 

На второй схеме изображено половое размножение одноклеточной водоросли. При демонстрации схемы необходимо объяснить учащимся, что сливающиеся гаметы принадлежат различным водорослям.

Монтаж схемы №2 (Половое размножение)

 

4. Теория вопроса

Хламидомонада, принадлежащая к роду вольвоксовых водорослей, является одноклеточным организмом. Ее клетки подвижны и имеют по два длинных жгутика и гладкую оболочку. Клетки имеют пристенный хроматофор, содержащий хлорофилл, ядро и светочувствительный глазок.

Размножается хламидомонада как бесполым, так и половым путем. Бесполое размножение осуществляется делением на 2-8 зооспор (на данной схеме 4 штуки). После деления оболочка хламидомонады разрывается и зооспоры выходят наружу.

Но наряду с бесполым размножением у хламидомонады известен и половой процесс, называемый изогамией. При изогамии происходит образования множества (на данной схеме 8 шт.) гамет, которые не отличаются морфологически, но имеют различные биохимические свойства. Благодаря этому гаметы одной водоросли сливаются не между собой, а всегда с гаметами другой хламидомонады. После слияния гамет образуется циста, защищенная прочной оболочкой. В состоянии цисты хламидомонада способна пережить неблагоприятные условия. При наличии благоприятных условий оболочка цисты разрывается и из нее выходят молодые хламидомонады.

5. Правила хранения

Хранить модель следует в сухом отапливаемом помещении, при температуре около 15-250С и влажности не более 80%.

После демонстрации рекомендуется проверить комплектность модели.

 

 

 

OТДЕЛ ЗЕЛЕНЫЕ ВОДОРОСЛИ

Этот отдел включает около 7000 видов, представленных, в основном, пресноводными одноклеточными, нитчатыми, колониальными, слоевищными формами. Зеленые водоросли большей частью обитают в пресноводных водоемах и имеют зеленую окраску из-за преобладания хлорофилла (хлорофиллы а, b) над другими пигментами (каротиноидами). Основное запасающее вещество клеток этих водорослей – крахмал, а в состав клеточной стенки входят целлюлоза, гемицеллюлозы и пектиновые вещества.

Представителями данной группы водорослей являются хламидомонада, спирогира, улотрикс, хлорелла.

Хламидомонада – это одноклеточная подвижная водоросль, живущая в стоячей воде. Ее тело имеет овальную, грушевидную или шаровидную форму. Клетка одета прочной оболочкой. На переднем конце

хламидомонада несет два одинаковых жгутика, с помощью которых она

активно передвигается в воде. Протопласт содержит одно ядро, обычно чашевидный хроматофор, две пульсирующие вакуоли, красный глазок (стигму). Стигма воспринимает изменения в интенсивности освещения, и водоросль перемещается туда, где интенсивность света оптимальна для фотосинтеза.

восстанавливается гаплоидное состояние, характерное для взрослых организмов. Молодые клетки высвобождаются и дают начало взрослым особям (рис.2, 3-5).

Улотрикс – многоклеточная нитчатая зеленая водоросль, обитающая в проточных водоемах. Ведет прикрепленный образ жизни. Нити водоросли состоят из ряда коротких клеток. В цитоплазме каждой из них расположены ядро и хроматофор в виде незамкнутого кольца.

Взрослое растение улотрикса гаплоидно. Бесполое размножение осуществляется с помощью зооспор. При этом каждая клетка, кроме той, с помощью которой нить прикрепляется, может разделиться на 2 или 4 подвижные зооспоры. Они выходят в воду, плавают, затем прикрепляются к какому-либо подводному предмету и делятся, образуя новые нити улотрикса (рис.3, 1).

 

Рис.2. Схема жизненного цикла хламидомонады: 1 – образование зооспор; 2 –

образование гамет; 3 – слияние гамет; 4 – зигота; 5 – «прорастание» зиготы

Взрослая особь хламидомонады гаплоидна. Имеет два типа размножения: бесполое и половое. Бесполое размножение осуществляется с помощью зооспор. Материнская клетка сбрасывает жгутики и делится на 2-8 частей путем митоза. Из каждой зооспоры вырастает взрослая хламидомонада (рис.2, 1).

Половой процесс (изогамия, гетерогамия) заключается в образовании и слиянии гамет. Гаметы образуются внутри материнской клетки так же, как зооспоры, но в большем количестве и, соответственно,

меньших размеров (рис.2, 2). Процесс оплодотворения происходит в воде.

 

 

Рис.3. Строение клеток зеленых нитчатых водорослей: 1 – улотрикс; 2 — спирогира

В неблагоприятный период в некоторых клетках водоросли образуются многочисленные мелкие одинаковые гаметы со жгутиками. Гаметы выходят в воду и сливаются попарно. Причем обычно сливаются гаметы, возникшие на разных особях. Зигота покрывается толстой оболочкой и может долго находиться в состоянии покоя. При наступлении благо- приятных условий зигота делится мейозом на 4 клетки. Каждая из них способна дать начало новому организму.

Образующаяся зигота покрывается плотной оболочкой и оседает на дно водоема. После периода покоя зигота делится мейотически, при этом

Спирогира — нитчатая неветвящаяся водоросль, живущая в водоемах

с непроточной, но чистой водой. Большинство видов спирогиры –

плавающие формы со слизистыми скользкими нитями. Клетки соединены

торец в торец и идентичны друг другу. В центре клетки расположена большая вакуоль. Хроматофоры – спиралевидные (рис.3, 2). Вегетативное размножение осуществляется частями таллома, то есть путем разрыва нитей на отдельные участки или даже отдельные клетки.

Половой процесс – конъюгация. При половом размножении две нити располагаются параллельно друг другу и супротивные клетки обеих нитей соединяются при помощи копуляционных выростов или мостиков. Оболочки их в месте соприкосновения растворяются, и образуется сквозной канал, через который сжавшееся содержимое клетки одной нити перетекает в клетку другой и сливается с ее протопластом. Образующаяся в результате оплодотворения зигота после периода покоя прорастает. Этому предшествует редукционное деление ядра: из четырех получившихся ядер три отмирают, а одно остается ядром единственного проростка, выходящего через разрыв наружных слоев оболочки зиготы.

Хлорелла – шаровидная одноклеточная водоросль, встречающаяся в пресных водоемах, почве. Клетки одеты оболочкой, содержат чашевидный хроматофор. Половой процесс отсутствует. При бесполом размножении материнская клетка делится на 4-16 клеток. Образуются неподвижные споры, которые входят наружу после разрыва материнской оболочки.

Хлорелла характеризуется высокими темпами размножения. Каждая клетка в течение суток может образовывать до 10 дочерних клеток. Богата белками, неприхотлива. Широко используется в научных исследованиях.

 


Конспект занятия 20. Ход занятия

Конспект занятия 20. Ход занятия — страница №1/1


Конспект занятия 20.

Ход занятия:


Ученики отвечают на часть заданных ими на прошлом занятии вопросов (на доске трое рисуют клеточный цикл, митоз, выстраивают схему летнего цикла хламидомонады, остальные по нему отвечают на вопросы).

Вопросы, на которые, в основном, должны ответить сами (если подумать).

Как перераспределяет клетка все на 2 новые клетки?

Перед делением происходит репликация (удвоение ДНК). Во время митоза хромосомы поровну распределяются между дочерними клетками. Так обеспечивается точная передача И (генетической информации). Митохондрии, рибосомы, эндоплазматическая сеть и другие органоиды распределяются примерно поровну во время деления цитоплазмы в телофазе митоза.

Как образуется так много хламидомонад? Как развиваются зооспоры в хламидомонаде?

Происходит несколько митозов (если 2, то получатся 4 зооспоры, если 3 – то 8, если 4митоза – то16 зооспор).

Как называются клетки, на которые хламидомонада разделяется?

Зооспоры. Зооспоры растут, превращаясь в большую, взрослую хламидомонаду.

Что происходит с растением, которое уже размножилось? Умирает ли исходная хламидомонада? Если нет, то куда девается?

Все содержимое исходной клетки при митозах переходит в дочерние клетки – зооспоры. От исходной клетки остается только пустая лопнувшая клеточная стенка.

Как растут, чем питаются? Как поддерживают жизнедеятельность зимой? Откуда АТФ? Что они едят? Есть ли питание, кроме фотосинтеза?

Хламидомонада — автотроф. Питается фотосинтезом. Чтобы получить больше света, переплывает с помощью жгутиков в более освещенное место. Рецептором света служит глазок. В процессе фотосинтеза образуется запас крахмала, который и позволяет получать энергию во время митоза, во время зимовки. Кроме фотосинтеза, хламидомонады могут питаться и гетеротрофно, всасывая органические вещества (как грибы) и даже поедая бактерий (как одноклеточные животные).

Зачем вообще хламидомонада? Она живет же не только, чтобы размножаться? Роль в водоеме.

Хламидомонада, как и все фотосинтетики, является продуцентом. Одноклеточными водорослями, в том числе хламидомонадами, питаются мелкие животные – амебы, инфузории, дафнии, то есть зоопланктон – консументы первого порядка. Зоопланктон служит пищей более крупным консументам. Значит, хламидомонада стоит в начале пищевой цепи.


  1. На летнем цикле хламидомонады раскрашиваем стрелки цветами клеточного цикла, подписываем, сколько в какой момент хромосом.

  1. Анализ летнего цикла хламидомонады с точки зрения клеточного цикла и митоза (число хромосом на каждом этапе).

Учитель сообщает, что в клетке взрослой (готовой образовать зооспоры) хламидомонады 17 хромосом. Ученики подписывают на схемах в тетради и на доске число хромосом возле изображения каждого этапа образования зооспор. Их везде по 17.
Достраивается на доске (из магнитных рисунков) схема зимнего цикла. Учитель уточняет схему зимнего цикла хламидомонады, показывая количество ядер в клетках. Обнаруживается, что мелкие клетки, получившиеся от разных хламидомонад, не просто объединяются на зиму, сливаясь цитоплазмами. Объединяются и их ядра!

Далее отмечаем число хромосом на всех этапах жизненного цикла хламидомонады.

Ученики обнаруживают тот факт, что в клетке, получившейся путем слияния двух клеток, 34 хромосомы, а на выходе из оболочки – 4 клетки по 17 хромосом. Таким образом, это не может произойти митозом (иначе было бы 4 клетки с 34 хромосомами в каждой). Вика: «Это какой-то волшебный митоз».

Посмотрели анимацию «Размножение хламидомонады» из Единой коллекции цифровых образовательных ресурсов. Узнали новые термины и вписали их в схему:



  • бесполое размножение

  • половое размножение

  • гаметы (половые клетки)

  • зигота

  1. Новое для нас в жизни хламидомонады.

Ученики письменно отвечают на вопрос: «С чем новым мы встретились в схеме жизни хламидомонады зимой?» Были найдены 2 главные «новости».

Слияние двух половых клеток (слияние двух гамет в зиготу). В нашем курсе был случай слияния клеток – образование мышечных волокон, но там не было слияния ядер.

Другой способ деления (способ деления клетки, при котором из одной клетки с диплоидным набором хромосом 2n получается 4 клетки с гаплоидным набором

хромосом n).


Полина: Странный «зимний митоз».

Вера: Двойной митоз при одном удвоении.

Вика: Иной митоз.

У: Что общего с митозом?

Д: То, что клетка делится и ДНК удваивается.

У: Отличие?

Д: Уменьшается число хромосом. Из одной клетки получается четыре. Клетки получаются идентичные самой начальной, а не той, которая делится. Клетка, в которой 2n хромосом превращается в 4клетки с n хромосом в каждой (см. схему). Т.е. это не митоз, а другой способ деления.


Гаплоидный набор хромосом – число хромосом в гаметах [17]

Диплоидный набор хромосом двойной набор хромосом [34]


5. Чтение текста про солнечника (в тексте надо найти названия для слияния двух половых клеток и другого способа деления).

Наблюдая за жизнью солнечников (родственников амебы) в аквариуме, ученым удалось проследить преемственность в потомстве одного-единственного солнечника на протяжении 1244 поколений. Размножаются солнечники, делясь митозом на 2 клетки. Уже в десятом поколении число солнечников, берущих начало от своего прародителя-одиночки, должно теоретически составлять ____ (сколько особей?), а к моменту появления тысячного поколения его численность выражается поистине астрономической цифрой.

Казалось бы, благополучие в царстве солнечников должно быть полностью гарантировано этой их способностью к бесполому размножению. Однако более пристальное изучение образа жизни этих созданий показало, что дело обстоит не совсем так. Если мы будем день за днем наблюдать за солнечниками, пользуясь сильным микроскопом, то однажды сможем заметить нечто странное, происходящее с одним из этих созданий. Начинается все с того, что солнечник втягивает внутрь цитоплазматического тельца свои лучи-ложноножки, теряя сходство с великим светилом, по имени которого он получил свое название. Затем вокруг ставшего шарообразным комочка цитоплазмы образуется плотная оболочка, после чего тело солнечника делится пополам, как и при обычном бесполом размножении.

Но этим дело не ограничивается, и ядро каждой из двух образовавшихся клеток делится снова, а затем еще раз. После каждого из этих делений одна “половинка” ядра отмирает. В результате всех этих преобразований, именуемых мейозом, под наружной оболочкой мы снова обнаруживаем две клетки — столько же, сколько их было здесь после первого деления солнечника надвое. Вскоре после этого одна из двух клеток выпячивает короткие ложноножки, направленные в сторону второй клетки. Ложноножки внедряются в тело другой клетки, цитоплазма обоих соседей постепенно сливается воедино, а их ядра движутся по направлению друг к другу и тоже соединяются. После этого оболочка распадается, заключенная в ней единственная клетка выпускает из себя длинные лучи-псевдоподии и превращается в полное подобие того солнечника, с которым произошли все эти странные метаморфозы. Наше возродившееся создание отправляется в свободное плавание и вскоре делится пополам, давая начало новым поколениям солнечников.

Все те события, которые только что прошли перед нашими глазами, есть не что иное, как половой процесс, вклинившийся в череду бесполых поколений солнечников. Это утверждение может звучать несколько странно, если принять во внимание, что у солнечников пол, по сути дела, отсутствует. У этих созданий нет подразделения на женских и мужских индивидов, на самцов и самок. И если ученые убеждены, что наблюдавшиеся нами метаморфозы тесно связаны с явлением пола, то в данном случае имеет место нечто вроде самооплодотворения. И в самом деле, те две клетки, которые слились друг с другом на конечной стадии процесса, мы вынуждены считать половыми клетками, или гаметами, начало которым дал один и тот же бесполый (или двуполый) организм.

Итак, на вопрос, возможна ли жизнь в отсутствие пола, приходится ответить положительно. Если пример солнечника не вполне убеждает нас в этом, поскольку в бесконечной череде бесполого размножения он все же изредка прибегает к половому процессу, то амеба, скажем, не знает ничего иного, кроме бесполого деления пополам. С другой стороны, половой процесс в той или иной своей форме присущ подавляющему большинству органических видов — от бактерии до человека. А это значит, что он может давать какие-то преимущества перед монотонностью бесполого существования. И, наконец, на вопрос о том, имеется ли простая и однозначная связь между полом и размножением, следует с определенностью ответить: нет. И в самом деле, мы видели, что у солнечника размножение (то есть увеличение числа особей) происходит путем деления их надвое (с сохранением после каждого деления двойного набора хромосом), а в результате полового процесса место приступившего к нему солнечника занимает всего лишь один-единственный индивид.

Я хотел было написать “тот же самый солнечник”, но вовремя остановился.

(По Е.Н.Панову)

Названия для новых явлений найдены и вписаны в тетради и на доску.

Слияние двух половых клеток – половой процесс (оплодотворение) – слияние двух гамет в зиготу. У хламидомонад 19 полов!
Другой способ деления – мейоз (способ деления клетки, при котором из одной клетки с диплоидным набором хромосом 2n получается 4 клетки с гаплоидным набором

хромосом n).


Д.З.
1) Выучить записи в тетради. Знать все новые слова.

2) На отдельных листах описать (рукописно) по любым источникам 3 примера полового размножения и 3 примера бесполого. Объем для каждого из этих примеров не меньше, чем полстраницы. Сдать эту работу в понедельник ответственным в каждом классе для подведения итогов.

Отдел зеленые водоросли | Помощь школьникам

К зеленым водорослям относятся как одноклеточные растения (хлорелла, хламидомонада), так и многоклеточные, достигающие больших размеров (спирогира, улотрикс и др.). Все они объединены общим признаком — наличием в клетках зеленого пигмента, не маскируемого пигментами других окрасок. Все зеленые водоросли фотосинтезируют.

Типичным представителем одноклеточных зеленых водорослей является хламидомонада, которая по своему строению похожа на жгутиковых. Это одноклеточная овальной формы водоросль, имеющая два жгутика.

Клетка водоросли состоит из цитоплазмы, ядра, чашеобразного хроматофора с пиреноидом, красного глазка, пульсирующей вакуоли и оболочки.

Живут хламидомонады в лужах, на сырой земле. Размножаются как бесполым путем, зооспорами, так и половым. Встречаются все три формы полового размножения: изогамия, гетерогамия, оогамия.

Интересным представителем одноклеточных зеленых водорослей является хлорелла, виды которой живут в пресной воде, на влажной почве, на стволах деревьев, даже в симбиозе (взаимовыгодное сожительство) с животными (инфузориями, гидрами, червями).

Хлорелла в переводе означает зеленушка. Она давно привлекает к себе внимание ученых прежде всего своими необыкновенными питательными свойствами. Интересны хлореллы тем, что очень интенсивно фотосинтезируют, создавая при этом большое количество органического вещества, значительно больше, нежели другие зеленые растения.

Урожай хлореллы в течение суток составляет до 200 кг/га, что вдвое превышает урожай кукурузы. Собранная масса хлореллы на 50% состоит из белков, на 22% — из жиров, на 12% — из углеводов, на 10% — из минеральных солей. Хлорелла содержит витамины А, В, С. Например, витамина С в ней содержится в 100, а витамина А в 500 раз больше, чем в молоке. Витамина С в хлорелле вдвое больше, нежели в лимонном соке. В ее составе имеется десять незаменимых для животных аминокислот.

Наконец, хлорелла в недалеком будущем в космическом корабле поможет создать замкнутый круговорот веществ, необходимый для обеспечения космонавтов пищей и кислородом в длительных полетах, что отражено в схеме.

Хлорелла — это растение, выполняющее космическую роль, о чем мечтал основоположник научной астронавтики К. Э. Циолковский. Он писал: «Как земная атмосфера очищается растениями с помощью Солнца, так может обновляться и искусственная атмосфера космического корабля».

Кроме одноклеточных водорослей, есть еще и колониальные формы, типичным представителем которых является вольвокс, или волчок. Эта водоросль представляет собой шарообразную колонию клеток, расположенных одним слоем. Внутренняя часть шара заполнена слизью. Число клеток в колонии до 50 000. Очень крупные шары-колонии достигают величины булавочной головки и видимы невооруженным глазом. Живет вольвокс в пресных сточных водоемах, непересыхающнх лужах.

Из многоклеточных водорослей у нас наиболее распространены нитчатые водоросли улотрикс и спирогира. Нити улотрикса достигают 10 см в длину. Ими улотрикс прикрепляется к подводным камням и корягам. Живет улотрикс в пресных водоемах.

Бесполое размножение совершается зооспорами. Половое размножение происходит по типу изогамии.


Использование естественного отбора для изучения адаптивного потенциала Chlamydomonas reinhardtii

Изменения скорости роста

C. reinhardtii и размера клеток

После 283 последовательных переносов в жидкую среду TAP при постоянном освещении (около 1880 поколений) эволюционировавшая популяция C. reinhardtii имела время удвоения, которое составило ок. На 35% ниже, чем у исходной популяции. Эта относительно более высокая скорость роста, представляющая интерес для промышленных приложений [4], была достигнута в течение 100 последовательных переносов (ок.6 месяцев). Ожидается обратная зависимость между скоростью роста и размером клеток, поскольку меньший средний размер клеток (то есть большее отношение поверхности к объему), по-видимому, обеспечивает большую способность приобретать питательные вещества для поддержания повышенной скорости роста [29], [30]. Удивительно, но клетки PL и EL не демонстрировали такой тенденции без существенной разницы в размерах клеток во время фазы экспоненциального роста (рис. 2). Повышенная скорость роста популяции EL в среде TAP, скорее всего, объясняется более эффективным поглощением и метаболизмом ацетата [11], что подтверждается наблюдением, что клетки PL и EL имели значительно более низкую, но одинаковую скорость роста в отсутствие этого органического углерода. источник.Используемые здесь условия непрерывного освещения также могут играть роль в изменении размера клеток и увеличении скорости роста [31], наблюдаемых во время стационарной и экспоненциальной фаз соответственно.

Изменения в геноме

C. reinhardtii

В этом исследовании мы сравнили геном двух популяций C. reinhardtii после 17 месяцев серийного переноса в режиме постоянного освещения и в присутствии источника органического углерода. Мы оценили частоту мутаций как 1.53×10 −8 /база/поколение для популяции EL, что в 47–226 раз выше предыдущих оценок, сделанных для этого вида (3,23×10 −10 и 6,76×10 −11 ), но сравнимо с высшие растения, такие как A. thaliana (5,9×10 -9 , таблица S3) [27], [32]. Этот результат не удивителен, если принять во внимание, что путь репарации ДНК был подавлен в эволюционировавшей популяции C. reinhardtii (см. обсуждение экспрессии на уровне генов), что, возможно, привело к более высокой частоте мутаций, чем предполагалось ранее для этот вид.Среди 1782 SNP/инделей с одним основанием мутации благоприятствовали переходам G:C→A:T (30,1% и 22,0% для A:T→G:C, таблица S3), как уже было показано в предыдущих исследованиях [27]. [32] и согласуется с повышенным содержанием GC 61,74% в ядерном геноме C. reinhardtii .

Расположение SNPS/Indels, обнаруженных в геноме C. reinhardtii популяции EL, составляло 47,2% в межгенных областях, 12,4% в экзонах, 24,2% в интронах и 16,2% в UTR (таблица S3). Это распределение значительно отличается от случайных ожиданий (p<0.05) и отличается от предыдущих исследований, основанных на меньшем числе SNP/инделей, обнаруженных из-за низкой частоты мутаций у этой водоросли [27], [32].

Анализ различий ДНК между популяциями клеток C. reinhardtii PL и EL показал, что 83 гена содержат несинонимичные замены. Из них обратная транскриптаза, связанная с не-LTR-ретротранспозоном (Cre01.g006700.t1.21), которая значительно повышалась в популяции EL, вероятно, указывает на стрессовую реакцию в этих клетках [33].Другой ген с дифференциальной экспрессией (повышение регуляции) кодирует гистидинкиназу с доменом родопсина (Cre07.g329900.t1.3) на N-конце. Этот белок родственен недавно описанным светоактивируемым хромопротеинам C. reinhardtii , которые опосредуют сигнальные процессы [34]. Следовательно, SNP в этом гене могут иметь функциональные последствия для клеток EL. Помимо этих двух примеров SNP, связанных с генами, демонстрирующими различия в экспрессии в популяции EL, большинство идентифицированных нами SNP/indels, вероятно, отражают генетический дрейф из-за режима серийного переноса.Мы также ожидаем, что некодирующие области будут первичными мишенями для изменений последовательности ДНК в клетках EL с потенциальным воздействием на эпигенетические изменения (например, локусы микроРНК), регулирующие экспрессию генов. По этим причинам, а также из-за невозможности использовать данные краткого считывания Illumina для сборки с высокой достоверностью некодирующих повторяющихся областей в очень сложном геноме C. reinhardtii , мы изучили данные об экспрессии генов в поисках подсказок для объяснения фенотипа EL. .

Изменения в

C.reinhardtii транскриптом

Это исследование является первым, в котором анализируются глобальные различия экспрессии генов у зеленых водорослей в результате длительной экспериментальной эволюции. После 17 месяцев при постоянном освещении и использовании ацетата в качестве источника углерода наши результаты демонстрируют, что экспрессия генов в эволюционировавшей популяции (EL) C. reinhardtii существенно отличается от популяции-предшественника (PL). Аналогичный эксперимент, проведенный с пресноводным штаммом бурой водоросли Ectocarpus , который в течение 6 месяцев подвергался воздействию морской воды, показал, что эта водоросль способна адаптироваться к новой среде.Экспрессия генов была сильно модифицирована у пресноводного штамма, так что она напоминала паттерн экспрессии морского представителя этого вида [35].

Анализ данных секвенирования РНК из популяции EL показал, что на сегодняшний день наибольшее количество значительно повышающих регуляцию генов кодирует рибосомные белки (рис. 3А, рис. S3). Одновременно с этим акцентом на продукцию белка в клетках EL была значительная повышающая регуляция генов, участвующих в транспорте РНК, для облегчения экспрессии генов и поддержки трансляции.К ним относятся субъединицы фактора инициации трансляции и две субъединицы РНК-полимеразы (таблица S4). Эти результаты согласуются с известной корреляцией между более высоким содержанием рибосомного белка и трансляцией белка с увеличением скорости клеточного роста [36].

Пути, регулируемые значительно ниже в популяции EL, включали биосинтез вторичных метаболитов (33/44 функции генов), репликацию ДНК (8/10 функций генов) и фотосинтез (например, 4/4 антенных белков), причем последний, вероятно, является реакция на непрерывный свет.Что касается пути репликации ДНК, комплекс поддержания мини-хромосомы (MCM) был значительно подавлен (Fig. 3B). Несколько генов клеточного цикла (например, SCF, CycA, PCNA) регулировались с повышением, как и следовало ожидать в быстро делящейся клеточной популяции (рис. S4). Комплекс MCM представляет собой геликазу, имеющую решающее значение для репликации и удлинения ДНК, которая действует в фазе G 1 как часть перехода от пререпликативного (пре-RC) к преинициаторному комплексу [37], [38]. У делящихся дрожжей пониженная экспрессия белков комплекса MCM приводит к нестабильности генома и повреждению ДНК (т.т. е. обилие pre-RC важно для выживания при репликационном стрессе, вызывающем двухцепочечные разрывы ДНК [39], [40]. Несмотря на его ключевую роль в поддержании целостности генома в условиях стресса [41], этот комплекс был значительно снижен в популяции EL, как и гены, кодирующие ДНК-полимеразу типа B-альфа, дельта-субъединицу ДНК-полимеразы 1 и загрузчик PFC-clamp. Значительная активация ферментов PCNA и RPA, участвующих в репликации ДНК и репарации повреждений (рис. 3Б), может свидетельствовать о том, что в клетках EL был достигнут баланс между скоростью (за счет повышенной скорости роста) и точностью репликации ДНК. .

Эти результаты также должны отражать воздействие постоянного света на клетки EL, что, вероятно, приводит к потере или нарушению циркадных часов у C. reinhardtii , которые сбрасываются синим/зеленым и красным светом [42]–[44]. Чтобы проверить эту идею, мы искали значительные различия в экспрессии генов среди ряда генов, связанных с часами, у этой водоросли [42]. К ним относятся гены RHYTHM OF CHLOROPLAST (ROC) [43], криптохромы ( CPh2 ), фототропины, фитохромы и казеинкиназы ( CK1 , CK2B ).Связанные с часами гены, которые показали значительное подавление, были CPh2 , которые кодируют криптохром, связанный с фотолиазами ДНК, которые действуют как фоторецепторы, разрушающиеся на свету [45]. Белки, содержащие серин/треонинкиназный домен, гомологичные казеинкиназе ( CK2B ), также продемонстрировали значительное снижение активности, тогда как другая казеинкиназа, связанная с жгутиковым протеомом ( CK1 ) [46], показала значительное повышение уровня регуляции (табл. С4). Оба этих последних гена предположительно фосфорилируют компоненты циркадных часов.Следовательно, воздействие длительного воздействия непрерывного света на клетки EL, вероятно, оказывает комплексное воздействие на циркадные часы водорослей, которые еще предстоит полностью понять. Кроме того, сильный световой стресс может привести к непосредственному повреждению ДНК у C. reinhardtii [47], хотя клетки EL не подвергались воздействию яркого света, и если это так, это, по-видимому, привело бы к усилению регуляции генов, кодирующих комплекс MCM.

Учитывая ключевую роль ацетата в усилении роста EL, мы исследовали метаболизм этого органического источника углерода при °C.Рейнхардт . У этой водоросли ацетат может быть включен в ацетилкоэнзим А двумя способами, оба из которых требуют АТФ. Первый – это прямое действие ацетил-КоА-синтетазы, а второй – через двухстадийную реакцию, в которой участвуют ацетаткиназа и фосфатацетилтрансфераза (например, [48], [49]). В то время как последняя реакция не показывает значительной дифференциальной регуляции в клетках EL, мы обнаруживаем 9-кратное увеличение содержания мРНК цитозольной ацетил-КоА-синтетазы (таблица S4), что позволяет предположить, что это основной путь ассимиляции ацетата.Ацетил-КоА поступает в дыхательный цикл трикарбоновых кислот (ТКА) в митохондриях, продуцируя НАДН и ассимилирующие метаболические предшественники, или входит в глиоксилатный цикл, что приводит к общей ассимиляции углерода [11], [48], [49]. Ацетил-КоА также может проникать в пластиду для поддержки биосинтеза липидов, особенно в условиях ограничения азота [50], [51]. На свету энергия, необходимая для ассимиляции ацетата, получается за счет циклического фосфорилирования фотосистемы I [49]. Учитывая эти существующие знания, наши данные в целом согласуются с предыдущими наблюдениями, показывающими, что гетеротрофный рост приводит к подавлению фотосистем [52], [53].Транскрипты, кодирующие светособирающие белки, связывающие хлорофилл a/b, белки реакционного центра фотосистемы и пластидную [Mn] супероксиддисмутазу (MSD3; [54]), были значительно снижены, что позволяет предположить, что энергия, необходимая для ассимиляции ацетата, вероятно, поступает из дыхания. Однако количество мРНК, кодирующих различные изоформы ферментов в циклах ТСА и глиоксилата, демонстрирует смешанный характер изменений (таблица S4), что затрудняет определение потока углерода по этим путям.Доказательства выработки энергии за счет окислительного фосфорилирования представлены значительной повышающей регуляцией генов, кодирующих компоненты дыхательных комплексов, таких как NUOB12 , COX90 , PET191 , QCR и QCR9 (таблица S4). Клеточное дыхание требует кластеров Fe-S и гема и производит активные формы кислорода (АФК). В популяции EL обнаружена регуляция генов, участвующих в биогенезе митохондриального кластера Fe-S (например, ISC1 и ISU1 ), транспорте железа ( FTR1 ) и метаболизме митохондриальных АФК ( GPX3 , TRX3 , TRX4, ). ).В совокупности наши результаты показывают, что ацетил-КоА, вероятно, одновременно усваивается и выдыхается.

Разнообразие существенных различий в экспрессии генов, обнаруженных при сравнении PL-EL, обобщено на рис. 4. Особый интерес представляет влияние селекции на метаболизм липидов, что является ключевой целью улучшения штамма биотоплива. Наш анализ (рис. S5) показывает, что биосинтез жирных кислот (то есть предшественников запасных липидов) значительно снижен в популяции EL (т.e., fabD и fabH , которые участвуют в инициации и удлинении жирных кислот) в условиях высокой скорости роста. Учитывая этот результат, мы проверили, можно ли заставить быстрорастущие клетки EL продуцировать липиды за счет снижения содержания азота в среде, как это было показано для многих других водорослей [50], [51]. Окрашивание популяций PL и EL нейтральным липидным красителем Bodipy 493/503 [23] выявляет накопление липидов в обеих популяциях (рис. 5). Поэтому ацетил-КоА, который в основном использовался для поддержки роста водорослей в условиях избытка азота, был перемещен в пластиду в условиях ограничения азота для создания запасных соединений.

Рис. 5. Анализ продукции липидов в PL и EL популяциях C. reinhardtii при выращивании при постоянном освещении в жидкой среде TAP.

Показаны дифференциальные интерференционно-контрастные изображения (D), аутофлуоресценция хлорофилла (C), липидные тела (окраска Бодипи; L) и слияние (M). Обратите внимание, что клетки PL и EL обнаруживают регуляцию продукции липидов после истощения азота (-N) в среде.

https://doi.org/10.1371/журнал.pone.0092533.g005

Границы | Анализ конкурентного роста мутагенизированной Chlamydomonas reinhardtii, совместимый с камерой для выращивания овощей на Международной космической станции

Введение

Микроводоросли растут, превращая свет, воду и CO 2 в биомассу. Водоросли уже давно предлагались для космических систем жизнеобеспечения для переработки CO 2 и прямого или косвенного обеспечения астронавтов пищей (Brechignac and Schiller, 1992; Ai et al., 2008; Niederwieser et al., 2018; Матула и Набити, 2019). Многие виды микроводорослей фотосинтетически эффективны в условиях ограниченного освещения и небольшого объема, необходимых для производства в космосе (Kliphuis et al., 2012). Как одноклеточные организмы, микроводоросли легко культивировать с минимальными требованиями, и они обладают большим потенциалом для производства продуктов с добавленной стоимостью.

Как эукариотические, так и прокариотические виды, такие как Chlorella vulgaris и Arthrospira platensis соответственно, обычно считаются безопасными (GRAS) для потребления человеком (Caporgno and Mathys, 2018).Водоросли обладают питательными свойствами благодаря высокому содержанию антиоксидантов и белка с незаменимыми аминокислотами (Buono et al., 2014). Водоросли также богаты жирными кислотами ω-3, такими как эйкозапентаеновая кислота и докозагексаеновая кислота (Salem and Eggersdorfer, 2015). Каротиноид красных водорослей, астаксантин, имеет множество применений, включая способность защищать от повреждения сетчатки у животных (Wang et al., 2000; Katagiri et al., 2012; Liu et al., 2016; Otsuka et al., 2016; Shah). и др., 2016). Масла водорослей могут быть использованы в рационе будущих космонавтов, чтобы помочь смягчить вредное воздействие микрогравитации и космического излучения во время космического полета. Chlamydomonas reinhardtii является модельным организмом для одноклеточных водорослей с хорошо аннотированной последовательностью генома (Merchant et al., 2007). Хотя Chlamydomonas не отнесена к классу GRAS, исследования кормления не выявили вредного воздействия включения значительного количества биомассы водорослей в корма для животных (Baek et al., 2018; Murbach et al., 2018). Следовательно, Chlamydomonas можно использовать в качестве модели для других видов микроводорослей, корма для животных для космических пищевых систем или сырья для производства.

Несколько прошлых исследований выявляли или выращивали виды водорослей в космических условиях (Mergenhagen and Mergenhagen, 1989; Wang et al., 2006; Giardi et al., 2013; Niederwieser et al., 2018). Миссия космического корабля «Шаттл» в 1985 году использовала C. reinhardtii для изучения фототаксических реакций в условиях микрогравитации (Mergenhagen and Mergenhagen, 1989). Микрогравитация позволяла клеткам оставаться вблизи источников света во время космического полета, что позволяет предположить, что продуктивность фотосинтеза в космосе может быть выше. Напротив, Wang et al.(2006) выращивали цианобактерии в течение 15 дней на спутнике и обнаружили снижение роста по сравнению с наземным контролем. Однако температура и световые циклы наземного контроля не были адаптированы к космическим условиям. У спутника было два перепада температуры и два пропущенных дневных фотопериода, что не позволило сделать убедительные выводы о темпах роста. Джарди и др. (2013) сравнили реакцию фотосинтеза Chlamydomonas на мутанты D1 дикого типа и фотосистемы II (PSII) в стационарных культурах. Космический полет оказал большее негативное влияние на флуоресценцию ФСII в клетках дикого типа и негативно повлиял на рост клеток по возвращении на Землю.Советские и российские космические эксперименты показывают, что C. vulgaris имеет схожую кинетику роста в космосе и на Земле, но клетки испытывают космический полет как стресс (обзор в Niederwieser et al., 2018).

Влияние среды космического полета на крупномасштабное производство водорослей в настоящее время неизвестно. Чтобы протестировать производство микроводорослей в больших масштабах, Европейское космическое агентство (ЕКА) разработало фотобиореактор, который прокачивает жидкие среды по извилистому пути, трубчатому реактору (Bretschneider et al., 2016). Газообмен обеспечивается мембранами из фторированного этилена и пропилена (FEP), которые обеспечивают диффузию CO 2 и O 2 , в то время как водоросли постоянно перемешиваются с помощью перистальтического насоса (Helisch et al., 2019). Этот фотобиореактор в настоящее время проходит испытания на Международной космической станции (МКС) для длительного выращивания C. vulgaris. Серьезной проблемой поддержания продуктивности фотосинтеза является регулярное удаление стационарных клеток и добавление новых сред для поддержания фотоавтотрофного роста без образования избыточных биопленок в дорожке качения.Кроме того, этот эксперимент с фотобиореактором не направлен на понимание генов, необходимых для роста в условиях космического полета (Helisch et al., 2019).

Эксперименты по конкурентному росту дрожжей в жидкой культуре использовались для выявления генов, необходимых для выживания в условиях космического полета (Nislow et al., 2015). Мы завершаем космические эксперименты, чтобы определить аналогичные наборы генов для Chlamydomonas путем конкурентного роста мутагенизированных клеток. Здесь мы сообщаем о результатах нашей разработки методов и проверки эксперимента (EVT).Мы описываем простой протокол периодического культивирования с использованием коммерческих пакетов для культивирования тканей FEP, адаптированных к камерам для выращивания растений Veggie на МКС. Мутагенез коротковолнового ультрафиолетового света (УФС) и полное секвенирование генома позволили обнаружить новые мутации в двух штаммах микроводорослей. Спектр идентифицированных мутаций предполагает, что UVC в первую очередь индуцирует повреждение ДНК у Chlamydomonas за счет ошибок в синтезе трансфузий и репарации двухцепочечных разрывов. Кроме того, может потребоваться модификация различных функций обработки клеточной информации, чтобы адаптировать Chlamydomonas к этой системе периодического культивирования.

Материалы и методы

Штаммы и условия культивирования

Штаммы

CC-5082 (WT) и CC-1883 ( cw15 ) были получены из Ресурсного центра Chlamydomonas. CC-5082 представляет собой клон CC-1690 с подтвержденной последовательностью, который представляет собой штамм дикого типа типа спаривания mt + (Gallaher et al., 2015). CC-1883 представляет собой мутант клеточной стенки mt cw15 , который позволяет трансформировать экзогенную ДНК путем встряхивания с клетками и стеклянными шариками (Kindle et al., 1989). Штаммы содержали при комнатной температуре (20–25°С) на агаризованных чашках с трисацетатно-фосфатной (ТАФ) средой (Gorman, Levine, 1965), при непрерывном фотосинтетически активном облучении 50–100 мкмоль/м 2 /с ( ФАР) от люминесцентных ламп дневного света (6500 К).

Для инициации жидких культур колонии размером 1–2 мм соскабливали с чашки с агаром TAP и инокулировали в 50–100 мл среды TAP. Традиционные жидкие культуры выращивали при постоянном освещении в колбах Эрленмейера на 250 мл при вращательном встряхивании со скоростью 100 об/мин.Для космических аналогов жидкие культуры выращивали при постоянном освещении в 120-мл пакетах для клеточных культур PermaLife (OriGen Biomedical, Остин, Техас, США). Жидкие культуры выращивали при дневном флуоресцентном освещении или в системе выращивания овощей в Космическом центре Кеннеди (Меррит-Айленд, Флорида, США) с соотношением красного (630 нм): зеленого (525 нм): синего (450 нм). 8:1:1 (Масса и др., 2016). Резервуар для овощей был установлен на максимальном расстоянии от светодиодного фонаря. Все освещение составляло 80–100 мкмоль/м 2 /с.

Доза мутагенеза УФ-С, вызывающая ~10% выживаемости клеток, определялась путем переноса 7 мл культуры в ранней логарифмической фазе при ОП 600 = от 0,45 до 15 см в стерильные чашки Петри в стерильном ламинарном боксе. Чашки Петри открывали в УФ-камере GS Gene Linker (Bio-Rad, Hercules, CA, США) и подвергали воздействию увеличивающихся доз УФ-излучения от бактерицидных ламп. Чашки Петри закрывали, заворачивали в алюминиевую фольгу и встряхивали в течение ночи в темноте со скоростью 50 об/мин. Мутагенизированные культуры высевали на чашки с агаром ТАР с необработанными образцами, разведенными 1:5 перед посевом.Колонии выращивали при постоянном освещении, подсчитывали и нормализовали относительно немутагенных культур.

Мутагенез EVT

Колонии с чашек с агаром TAP соскребали и суспендировали в 600 мкл жидкой среды TAP и доводили до оптической плотности 1 при 600 нм с помощью спектрофотометра видимого света (SmartSpec 3000, Bio-Rad, Hercules, CA, США). Суспензию Chlamydomonas использовали для инокуляции жидких сред ТАР в разведении 1:250, т.е. 0,2 мл суспензии OD 600 = 1 добавляли к 50 мл среды ТАР.WT инокулировали в 1-й день эксперимента, а cw15 — во 2-й день. Культуры выращивали в колбах до достижения OD 600 0,4–0,5 на 4-й день. секвенирование всего генома путем центрифугирования 2 мл культуры и замораживания клеточного осадка при -80°C до выделения ДНК. Для каждого мутагенеза 7 мл культуры с ранней логарифмической фазой подвергали воздействию 8 мДж УФ-света. Затем мутагенизированные клетки использовали для инокуляции 100 мл среды TAP в пакете для тканевых культур PermaLife в стерильном ламинарном боксе.Пакеты с инокулированными культурами тканей выдерживали при комнатной температуре в темноте в течение 7 дней, а затем переносили в камеру для выращивания Veggie.

Условия культивирования EVT и выбор

Вегетарианская камера была установлена ​​так, чтобы резервуар находился на максимальном расстоянии от источника света (Massa et al., 2016). Красный свет с длиной волны 630 нм был установлен на «средний»; синий свет 450 нм был установлен на «низкий»; и зеленый свет 525 нм был включен. Сильфоны были закрыты во время циклов роста, а вентилятор был установлен на «низкую скорость».Исходные мутагенизированные культуры выращивали в течение 7 дней в среде Veggie. Затем культуры пассировали путем переноса 1 мл культуры в пакет со свежей средой TAP с помощью стерильного шприца. Вторую культуру выращивали в течение 6 дней, а затем пассировали в третий мешок для тканевых культур на 6 дней роста. На каждом пассаже отбирали 2 мл культуры, центрифугировали и осадок клеток замораживали при -80°С до выделения ДНК. Остальные культуры хранили в мягком контейнере для перевозки грузов (CTB) до 36 дней после первоначальной инокуляции.Для каждой хранящейся в темноте культуры отбирали 2 мл для выделения ДНК.

Анализы роста

Кривые роста для не подвергшихся мутагенезу клеток были определены путем отбора 1 мл культуры каждый день и определения оптической плотности при 600 и 750 нм. Образцы культуры разбавляли, если измерения оптической плотности превышали 1. Плотность клеток подсчитывали с помощью гемоцитометра и световой микроскопии. Сухую биомассу определяли путем переноса всего оставшегося объема культуры в две центрифужные пробирки объемом 50 мл.Клетки центрифугировали, удаляя надосадочную среду, и осадки клеток лиофилизировали в течение ночи. Сухую массу измеряли на аналитических весах. Биомасса для каждой культуры представляет собой среднее значение двух технических повторностей.

Полногеномное секвенирование

ДНК

экстрагировали из замороженных и хранившихся в темноте клеточных осадков, как описано, с некоторыми незначительными модификациями (Newman et al., 1990). Осадок клеток ресуспендировали в 150 мкл H 2 O на льду и 300 мкл буфера SDS-EB (2% SDS, 400 мМ NaCl, 40 мМ ЭДТА, 100 мМ Трис-HCl, pH 8.0) добавляли и перемешивали. Затем клеточную суспензию экстрагировали 350 мкл фенола: хлороформа: изоамилового спирта 25:24:1 (об:об) в течение 2–5 мин путем прерывистого перемешивания с использованием вортекса. Органическую и водную фазы разделяли 5-минутным центрифугированием на максимальной скорости в микроцентрифуге. Затем водную фазу экстрагировали 300 мкл смеси хлороформ:изоамиловый спирт (24:1). РНК в водной фазе расщепляли РНКазой А при комнатной температуре в течение 10 мин. ДНК осаждали добавлением 1 мл 100% этанола, инкубацией на льду в течение 30 мин и центрифугированием в течение 10 мин.Осадок промывали 200 мкл 70% этанола, сушили в вакуумной центрифуге и ресуспендировали в 30 мкл H 2 O. Целостность образца ДНК оценивали с помощью Agilent TapeStation (Santa Clara, CA, США), концентрацию определяли. определяли с помощью набора для анализа dsDNA HS Qubit (Life Technologies, Карлсбад, Калифорния, США) в соответствии с инструкциями производителя.

Для каждой библиотеки 3 мкг ДНК разрезали до среднего размера 350 п.н. с помощью сфокусированного ультразвукового прибора S220 (Covaris, Woburn, MA, США).Библиотеки с низкой пропускной способностью TruSeq PCR-Free со штрих-кодом готовили для каждого образца ДНК в соответствии с инструкциями производителя (Illumina, Сан-Диего, Калифорния, США). Каждый образец имел уникальный индекс из Illumina TruSeq DNA CD Indexes (96 индексов на образец). Библиотеки были разделены на два пула для секвенирования в общей сложности 38 образцов: девять образцов, хранившихся в темноте, и девять образцов мгновенной заморозки для каждого штамма, цикла роста и биологической реплики, а также двух исходных культур без мутагенеза. Пулы библиотек были сбалансированы по цвету и секвенированы с чтением парных концов 150 п.н. на платформе Illumina HiSeq X в MedGenome (Фостер-Сити, Калифорния, США).

Обработка чтения и выравнивание генома

Чтения необработанных последовательностей были отфильтрованы с использованием Trimmomatic v.0.38 для удаления последовательностей штрих-кода и адаптера в режиме парного конца (Bolger et al., 2014). Чтения высокого качества были сопоставлены с эталонным геномом C. reinhardtii (Merchant et al., 2007), v.5.6 из Phytozome, с использованием BWA-mem (Li, 2013). Дубликаты чтения были удалены с помощью Picard MarkDuplicates, v.2.19.1 с параметрами по умолчанию. Считывания рядом с полиморфизмами вставки-делеции (InDel) были повторно выровнены с использованием GATK v.3.8.1 RealignerTargetCreator и IndelRealigner (McKenna et al., 2010; DePristo et al., 2011).

Идентификация вариантов последовательности

Было проведено сравнение трех программных пакетов для обнаружения однонуклеотидных полиморфизмов (SNP) и небольших вставок. FreeBayes v.1.2.0 (Гаррисон и Март, 2012 г.) был реализован с возможностью непрерывного объединения. В LoFreq v. 2.1.3.1 использовались параметры по умолчанию (Wilm et al., 2012), в то время как в CRISP объединены дискретные параметры:, 2011). FreeBayes назвал больше вариантов для библиотек с наименьшей глубиной, что дало отрицательную корреляцию между количеством сопоставленных чтений и количеством обнаруженных вариантов. LoFreq ограничен вызовом вариантов для отдельных образцов и не обнаруживает варианты на уровне популяции. Следовательно, CRISP был признан оптимальным подходом для обнаружения вариантов.

Для каждого штамма результаты генотипирования CRISP были отфильтрованы для удаления вариантов с частотой вызовов ниже 70% (т. е. отсутствующих данных ≥ 30%) и мономорфных вариантов с нулевой частотой минорного аллеля (MAF).Мономорфные варианты выявили немутированные, естественные варианты относительно эталонного генома. Кроме того, были удалены варианты с малой глубиной и низким качеством сопоставленных прочтений на основе назначений CRISP «LowDepth, LowMQ10 и LowMQ20». Наконец, новые варианты были оценены путем выявления точных совпадений с естественными вариантами, обнаруженными в результате полногеномного секвенирования 39 лабораторных штаммов Chlamydomonas (Gallaher et al., 2015). Плотность вариантов визуализировали путем нанесения SNP, обнаруженных в окнах 100, 400, 500 и 1000 т.п.н.Размер окна 400 т.п.н. был выбран визуально, поскольку он показывает самое высокое разрешение кластеров естественного варианта SNP.

Определение вариантов кодирования белка и отбор

Влияние каждого варианта на области, кодирующие белок, было предсказано с использованием SnpEff v.4.3t (Cingolani et al., 2012). Синонимичные и несинонимичные мутации из первичного вызова SnpEff использовали для оценки общего воздействия мутагенеза UVC на гены, кодирующие белок. Синонимическое (π S ) и несинонимичное ( π N ) разнообразие нуклеотидов оценивали для каждого гена с помощью SNPGenie (Nelson et al., 2015). SNPGenie запускали для всех высококачественных и новых вариантов независимо, используя как прямую цепь, так и обратную цепь комплемента. Положительный отбор предполагался, когда π N > π S , а очищающий отбор предполагался, когда π N < π S . Гены, демонстрирующие положительный или очищающий отбор, были протестированы на обогащение терминов генной онтологии (GO) с использованием AgriGO v2.0 с параметрами по умолчанию, за исключением метода корректировки нескольких тестов «Хохберга (FDR)» для коэффициента ложного обнаружения по умолчанию, равного 0.05 (Тиан и др., 2017).

Результаты

Мы протестировали коммерческие пакеты для тканевых культур FEP на способность поддерживать рост микроводорослей без перемешивания или активного смешивания газов с жидкостями. При дневном флуоресцентном освещении пакеты способны поддерживать устойчивый рост штаммов cw15 и WT (рис. 1A–D). Временные графики роста показывают задержку мешков на 1 день (рис. 1E-H). Регрессия логистической кривой роста оптической плотности показала, что максимальное время удвоения для cw15 составило 5.32 ч в колбах и 8,01 ч в мешках FEP (рис. 1E). Для WT максимальное время удвоения составило 7,42 ч для колб и 8,98 ч для пакетов FEP (рис. 1F). Аналогичное время удвоения было оценено по количеству клеток: 5,7 против 7,65 ч для cw15 и 7,3 против 8,73 ч для WT (рис. 1G, H). Подсчет клеток оценивал увеличение числа клеток в 600–1450 раз во время культивирования, что указывает на 9–11 удвоений клеток в периодическом культивировании. Сухая масса биомассы находилась в порядке ранжирования с измерениями оптической плотности и плотности клеток через 6 дней.Культуры в колбах cw15 имели самую низкую биомассу 0,61 г/л, а культуры в колбах WT имели самую высокую биомассу 0,95 г/л (рис. 1I). Мешки для тканевых культур FEP выросли до плотности клеток между культурами в колбах для cw15, и WT. Эти данные показывают, что пакеты обеспечивают достаточный газообмен для поддержания микроводорослей, но лабораторные штаммы Chlamydomonas растут быстрее в колбах.

Рис. 1. Рост микроводорослей в пластиковых культуральных пакетах из ФЭП. (A) Колба и (B) Пакетная культура FEP cw15 , CC-1883. (C) Колба и (D) пакетная культура FEP дикого типа (WT), CC-5082. Кривые роста водорослей cw15 (E, G) и WT (F, H) , сравнивающие культуры в колбах и в пакетах FEP. Символы являются средними значениями ( n = 5, кроме n = 4 для пакетов cw15 FEP). Линии тренда представляют собой регрессии кривой логистического роста. (I) Средняя биомасса, полученная после 6 дней культивирования. (J) Доза-реакция водорослей WT на УФ-излучение. Линия тренда представляет собой экспоненциальную регрессию. Столбики погрешностей на всех панелях представляют собой стандартное отклонение.

Чтобы идентифицировать гены, необходимые для роста в мешках для тканевых культур, мы мутагенизировали штаммы перед конкурентными анализами роста. Сначала мы определили зависимость доза-реакция на летальность клеток в световой камере УФС. На рисунке 1J показано, что 6-10 мДж УФ-излучения достаточно, чтобы убить примерно 90% клеток дикого типа. Сходные результаты были получены для cw15 , и мы пришли к выводу, что 8 мДж УФ-излучения могут нанести достаточное повреждение ДНК, чтобы вызвать мутации в обоих штаммах, не рискуя чрезмерной гибелью клеток и нарушением культивирования во время космического полета.

В Космическом центре Кеннеди был завершен EVT (рис. 2). Три биологических повтора WT и cw15 подверглись мутагенезу в Университете Флориды, Гейнсвилл, Флорида, США. Мутагенизированные клетки были перенесены в пакеты для тканевых культур со средой TAP и хранились при комнатной температуре в темноте в течение 7 дней, чтобы имитировать позднюю загрузку и хранение во время миссии по пополнению запасов на МКС. Затем культуры переносили в вегетарианскую камеру для обеспечения освещения и стимуляции фотосинтеза.Мешки с культурой были помещены под эластичные шнуры, которые удерживают подушки для растений в резервуаре для овощей (рис. 2B). Мешки оставляли без какого-либо перемешивания, кроме как во время пассажей (рис. 2С). Для завершения пассажа культуральные пакеты извлекали из резервуара, встряхивали вручную и 1 мл культуры переносили на свежую среду для нового цикла роста (рис. 2D–F). Отбирали дополнительные 2 мл культуры и осадки клеток замораживали, чтобы сохранить образец ДНК без хранения в темноте.

Рис. 2. Эксперимент по отбору водорослей в камере для выращивания овощей в Космическом центре Кеннеди. (A) Схема эксперимента и рабочего процесса. (B) Первоначальная установка пакетов с мутагенизированными культурами в резервуаре Veggie. (C) Вегетарианская камера с мешками для водорослей и закрытым мехом. (D) Культуры водорослей перед пассированием. (E,F) Пересев культуры с использованием стерильных шприцев.

Оставшаяся культура хранилась в закрытом контейнере CTB для имитации хранения в условиях окружающей среды на МКС и возвращения живых культур на Землю (рис. 3А).Через 36 дней после первоначальной инокуляции из всех культуральных мешков были отобраны образцы для выделения ДНК и оценки биомассы (рис. 3В). Штамм WT показал более высокую биомассу по сравнению с мутантом клеточной стенки cw15 ( p = 0,01, парный критерий Стьюдента t ). Внутри каждого штамма наблюдалась значительная тенденция к увеличению биомассы при дополнительных культуральных пассажах ( p <0,01, ANOVA). Однако все уровни биомассы были ниже, чем при немедленном сборе клеток после 6 дней культивирования без УФ-мутагенеза или хранения в темноте (рис. 1I).Наблюдаемые тенденции биомассы, скорее всего, отражают потерю биомассы из-за дыхания во время темного хранения.

Рис. 3. (A) Хранение живых культур водорослей в мягком вещевом мешке CTB. (B) Выход биомассы после хранения в темноте. Наносят на график среднее значение и стандартное отклонение для трех биологических повторностей. Строчными буквами обозначены статистически значимые группы культуральных пассажей на основе ANOVA каждого штамма и теста Tukey HSD.

Полногеномное секвенирование предварительно мутагенизированных культур, замороженных клеточных осадков и культур, хранящихся в темноте, было завершено со средней глубиной считывания 16x.Варианты, состоящие из SNP и коротких полиморфизмов InDel, вызывали с помощью CRISP с использованием параметров объединенной выборки (рис. 4). После удаления отсутствующих данных (≥30%) и мономорфных полиморфизмов (MAF = 0) мы обнаружили 73 573 варианта WT и 79 455 90 131 вариантов cw15 90 132. Фильтрация для удаления малоглубинных и низкокачественных прочтений уменьшила количество полиморфных вариантов WT и cw15 до 48 380 и 53 939 соответственно. Это представляет в среднем один вариант на 2,24 кб в WT и 2,01 кб в cw15 .

Рисунок 4. Конвейер анализа последовательности с ключевыми параметрами для вызова вариантов и фильтрации качества.

Построение графика плотности вариантов в геноме выявило известные очаги естественной изменчивости среди лабораторных штаммов (рис. 5, Gallaher et al., 2015). Штамм WT представляет собой проверенный по последовательности клон CC-1690, и полиморфные варианты идентифицировали перекрывающиеся пики на хромосомах 2, 6 и 9. Кроме того, были пики, которые перекрывались с другими природными вариантами на хромосомах 3 и 12.Штамм cw15 происходит от скрещивания с CC-1690, и наблюдалась аналогичная картина пиков природных вариантов. Эти естественные варианты могут представлять собой спонтанные мутации, которые легко переносятся Chlamydomonas, или участки генома, которые трудно выравнивать с высокой достоверностью. В любом случае известные естественные варианты, вероятно, будут иметь слабый сигнал отбора из-за индуцированного мутагенеза UVC. Мы удалили все точные совпадения с естественными вариантами, чтобы получить новые варианты 5286 WT и 5873 cw15 , которые более равномерно распределены по геному (рис. 5).Средняя плотность генома для новых вариантов составляла один вариант на 20,83 т.п.н. у WT и 18,75 т.п.н. у cw15 .

Рис. 5. Плотность вариантов SNP и indel в геноме Chlamydomonas. Ось Y представляет собой количество вариантов на 400 т.п.н., а ось X представляет собой физическое расстояние каждой хромосомы. Нанесенный на график вариантный набор данных помечен справа на каждой панели. Варианты из 39 лабораторных штаммов (черный, верхняя панель) и CC-1690 (черный, вторая панель), секвенированных Gallaher et al.(2015). Светло- и темно-серый цвет показывает все варианты высокого качества (этап 4 на рис. 4) в штаммах WT и cw15 . Оранжевый (WT) и зеленый ( cw15 ) отображают новые варианты после фильтрации идентичных совпадений с полиморфизмами в исследовании Gallaher et al. (2015) исследование (этап 5 на рис. 4).

Новые варианты демонстрируют иной спектр основных изменений, чем природные варианты (рис. 6А). Наблюдается относительное уменьшение переходов и увеличение трансверсий с преобладанием комплементарных мутаций A > C и T > G, а также C > G и G > C.Эти данные позволяют предположить, что новые варианты представляют собой мутации, вызванные индуцированным мутагенезом, а не эндогенный спектр вариантов Chlamydomonas. Кроме того, новые мутации обнаруживаются с более высокой частотой аллелей, что указывает на то, что новые мутации имеют большую поддержку чтения последовательности в образцах, чем естественные варианты (рис. 6B). Мы пришли к выводу, что новые варианты лучше представляют мутагенизированные сайты UVC.

Рисунок 6. Влияние фильтрации вариантов и хранения живой культуры на обнаруженные мутации. (A) Относительная частота изменений оснований и вставок для природных вариантов, обнаруженная Gallaher et al. (2015) и новые варианты после УФ-мутагенеза. (B) Распределение частот минорных аллелей для всех вариантов и новых вариантов. (C,D) Средняя глубина секвенирования трех библиотек биологических повторов, приготовленных из культур, хранящихся в темноте, и гранул водорослей, которые были заморожены во время пассажа. (E,F) Среднее число новых мутаций, обнаруженных в библиотеках хранящихся в темноте и замороженных тканей.Столбики погрешностей представляют собой стандартные отклонения.

Центрифугирование и замораживание клеточных осадков для взятия проб ДНК требует больше времени космонавтов и ограниченных ресурсов на МКС. Мы сравнили мутации, извлеченные из образцов, которые были заморожены во время пассажа, и мутации из живых культур, которые хранились в темноте. Не было никаких существенных различий в глубине секвенирования в зависимости от условий хранения (рис. 6C, D). Однако хранение в темноте уменьшило количество мутаций, обнаруженных в пассаже 1, когда культуры хранились в течение 22 дней до отбора проб (рис. 6E, F).Тесты Стьюдента t -тесты показали значительное снижение мутаций, обнаруженных для штамма WT ( p = 0,003), но снижение было незначительным для cw15 ( p = 0,07). Для замороженных хранимых библиотек количество новых мутаций, обнаруженных в каждом пассаже, было почти постоянным, что указывает на ограничение глубины секвенирования для обнаружения мутантов. Эти результаты позволяют предположить, что изменения частоты аллелей в культуральных пассажах не являются надежным индикатором отбора для этого эксперимента.

Чтобы оценить влияние новой мутации на последовательности, кодирующие белок, использовали SnpEff для выявления изменений, кодирующих белок. Природные варианты были обогащены синонимичными мутациями, в то время как новые варианты были обогащены изменениями, кодирующими белок (рис. 7А). Эти результаты согласуются с повышенной частотой вредных мутаций после УФ-мутагенеза. Отдельные гены тестировали на селекцию на основе разнообразия нуклеотидов (π) с использованием SNPGenie. Новые варианты были обогащены генами, демонстрирующими признаки положительного отбора, при этом около 46% протестированных генов имели π N > π S по сравнению с 29 % всех вариантов (фиг. 7B).Эти результаты согласуются с обогащением несинонимичными мутациями, возникающими в результате УФ-мутагенеза.

Рисунок 7. Новые варианты обогащены предсказанными изменениями кодирования белка. (A) Соотношение несинонимичных и синонимичных вариантов на основе аннотаций SnpEff. Белый и серый цвета показывают обнаруженные естественные варианты. Оранжевый и зеленый показывают новые варианты. (B) Средняя доля генов, показывающая положительную селекцию всех генов, протестированных с помощью SNPGenie.Средние значения взяты из шести библиотек на пассаж. Столбики погрешностей представляют собой стандартные отклонения. (C) Обогащенные термины GO для генов с положительным отбором.

На основании анализа обогащения терминов GO положительно выбранные гены в WT и cw15 демонстрируют значительное обогащение терминов, связанных со связыванием пуриновых нуклеотидов и гидролазной активностью (рис. 7C). Отдельные гены с этими терминами GO представляют функции обработки информации при восстановлении повреждений ДНК, обработке РНК, трансляции, моторах цитоскелета и передаче сигнала (дополнительная таблица S1).Библиотеки WT также были обогащены терминами, связанными с переносчиками малых молекул, с отдельными генами, преимущественно являющимися переносчиками ABC.

Штамм WT также имел значительное обогащение генов при очищающей селекции (рис. 8). Предполагается, что более половины этих генов функционируют в регуляции уровней вторичных мессенджеров циклических нуклеотидов, что позволяет предположить, что передача сигнала вторичных мессенджеров может находиться под селективным давлением в системе роста культурального мешка.Штамм cw15 не имел значительно обогащенных терминов GO для генов, прошедших очищающую селекцию.

Рисунок 8. Обогащенные термины GO для генов, демонстрирующие признаки очищающего отбора в штамме WT.

Обсуждение

Этот EVT подтвердил стратегию идентификации генов, необходимых Chlamydomonas во время логарифмической фазы роста в космическом полете. Мы показали, что коммерческие пакеты для тканевых культур FEP можно использовать для периодического культивирования микроводорослей, что приводит к удвоению 9–11 клеток в течение 6-дневного культивирования.Клетки в этих культурах, которые делятся нормально, будут по крайней мере в 1000 раз обогащены в стационарной фазе по сравнению с клетками с генетическими вариантами, которые предотвращают митотическое деление. Конкуренция за счет множественных пассажей устранит мутации, препятствующие митотическому росту. Хламидомонада жизнеспособна в этих мешках после длительного хранения в темноте, что позволяет проводить полное секвенирование генома и идентифицировать мутантные гены в культуре. С тех пор мы использовали эту стратегию для выращивания штаммов WT и cw15 во время миссии SpaceX CRS-15; анализ космического полета продолжается.

Секвенирование всего генома использовалось для оценки мутагенной нагрузки бактерий Staphylococcus aureus при двухнедельном космическом полете (Guo et al., 2015). Менее 40 SNP были обнаружены в геноме из космического полета с одинаковым количеством SNP, обнаруженным на земле и в космическом полете. Эти данные предполагают, что экзогенный мутагенез необходим для получения адекватного сигнала отбора в краткосрочных экспериментах по конкурентному росту.

Эксперимент по селекции дрожжей был завершен в космическом полете с использованием коллекции делеций всего генома (Nislow et al., 2015). В эксперименте по конкурентному росту было измерено снижение представленности мутантов со штрих-кодом в течение примерно 21 митотического поколения. Этот тип конкурентного роста идентифицирует отдельные гены, необходимые для роста. Напротив, мутагенез UVC имеет более высокую генетическую нагрузку и генерирует более разнообразный набор типов аллелей, конкурирующих внутри культуры. Более того, ожидается, что три серийные культуры Chlamydomonas дадут около 30 митотических поколений, потенциально дающих больше сигналов отбора в данных о последовательности генома.

Существует несколько ограничений дизайна этого анализа конкурентного роста. Водоросли выращивали в миксотрофных условиях, используя как ацетат, так и свет в качестве источников энергии. Добавление ацетата в среду способствует быстрому росту культур, что позволяет выполнить до четырех пассажей за 1 месяц коммерческой миссии SpaceX по пополнению запасов. Следовательно, ожидается, что гены при очищающем отборе будут включать пути использования ацетата. Точно так же камера для выращивания овощей имеет ограниченный спектр освещения с тремя узкими длинами волн, которые не включают дальний красный свет (Massa et al., 2016). Каждая длина волны имеет от двух до четырех настроек уровня освещенности, и освещение должно быть обогащено красным светом, чтобы обеспечить 80–100 мкмоль/м 2 света в секунду для культуральных мешков. Ограничения случайного мутагенеза заключаются в том, что мутации с потерей функции во всех генах не представлены в каждой биологической повторности эксперимента и что множественные мутации одновременно выбираются в отдельных клетках во время митотических делений. Более того, мы обнаружили, что все культуры имели высокий уровень полиморфизмов, идентичных ранее описанным природным вариантам у лабораторных штаммов (Gallaher et al., 2015). Глубина секвенирования и 30 митотических генераций эксперимента не обеспечили достаточной чувствительности для выявления изменений частот аллелей отдельных природных вариантов. Следовательно, мы сосредоточились на сигнатурах отбора в новых мутациях, которые были уникальными для культур с УФ-мутагенезом.

Ультрафиолетовый свет вызывает прямое повреждение ДНК с образованием димеров циклобутан-пиримидина, а сигнатура УФ-мутаций обычно смещена в сторону переходов C > T (Ikehata and Ono, 2011). ДНК Chlamydomonas легко образует пиримидиновые димеры, а штаммы WT имеют надежный путь темновой репарации, позволяющий восстанавливать 90–95% повреждений ДНК непосредственно в течение 24 часов (Small, 1987).При секвенировании всего генома мы наблюдали обогащение трансверсий T > G и C > G в мутациях, возникающих в результате обработки УФ-излучением, вместо ожидаемых переходов C > T. Включение нескольких продуктов окисления гуанина может способствовать C>G-трансверсиям в ответ на различные мутагены, включая УФ (Kino and Sugiyama, 2005). При раке человека изменения оснований C > G связаны с активацией цитидиндеаминаз AID/APOBEC с последующим подверженным ошибкам синтезом трансфузии (Forbes et al., 2017). Раковые заболевания человека также имеют сигнатуры замещения оснований, обогащенные T > G, такие как сигнатуры COSMIC 17b и 28 (Forbes et al., 2017). Однако не было предложено никаких конкретных механизмов для специфического обогащения трансверсий T > G.

Интересно, что мы наблюдали признаки отбора в ДНК-полимеразе ζ, θ и REV1 (дополнительная таблица S1), которые связаны с синтезом трансфузии (Sakamoto, 2019). Было высказано предположение, что в зародышевой линии человека мутации C > G вызваны ошибками в репарации разрывов с двойной стойкой (Gao et al., 2019). ДНК-полимераза θ и ДНК-лигаза 4 функционируют в пути восстановления негомологичного соединения концов двухцепочечного разрыва, и мы обнаружили доказательства отбора обоих этих ферментов в EVT (Pannunzio et al., 2018). Доказательства отбора при репарации двухцепочечных разрывов и синтезе трансфузии предполагают, что эти пути, вероятно, имеют отношение к наблюдаемым УФ-индуцированным мутациям.

Низкий охват последовательностей этого эксперимента создает риск при использовании частоты восстановления для конкретных мутантных аллелей при определении того, находятся ли определенные гены в положительном или очищающем отборе.Количество обнаруженных аллелей ограничено глубиной секвенирования, и необходим более высокий охват, чтобы увеличить мощность статистики для обнаружения отбора на уровне всего генома. Тем не менее, мы смогли классифицировать 476 генов в штамме WT и 503 гена в штамме cw15 для очистки или положительного отбора на основе мутаций в кодирующих последовательностях. Среди них 104 гена были обогащены молекулярными функциями на основе терминов GO. В дополнение к путям репарации ДНК эти анализы показали, что передача сигналов и другие функции обработки информации, включая чтение хроматина, обработку РНК и трансляцию, обогащены в выбранных генах.Предполагается, что обогащенные молекулярные функции являются процессами, необходимыми Chlamydomonas для адаптации к УФ-мутагенезу, отсутствию перемешивания среды, диффузии газов через FEP-мембрану и условиям освещения в отделении Veggie.

Масштабируемое производство Chlamydomonas в космическом полете имеет множество потенциальных применений. Этот вид будет накапливать липиды примерно до 20–25% от общей биомассы, которые можно использовать в качестве органического химического сырья (Becker, 2007; Xu et al., 2018). Chlamydomonas также имеет высокое содержание белка, составляющее 40–60% биомассы, что делает ее потенциальным источником пищи.Хотя FDA еще не определило его как организм GRAS, хламидомонада нетоксична; исследования кормления животных не выявили вредного воздействия при дозе 4 г биомассы водорослей на кг массы тела в день, что является самым высоким испытанным уровнем потребления (Murbach et al., 2018). Эквивалентное потребление для человека весом 65 кг составляет примерно 260 г порошка водорослей в день.

В качестве генетического модельного организма состав биомассы Chlamydomonas может быть дополнительно изменен путем мутагенеза или целенаправленного редактирования генов. Например, были выделены мутанты с избыточным накоплением крахмала, у которых содержание крахмала меняется с 15 до 30–35% биомассы (Koo et al., 2017). Точно так же редактирование гена CRISPR гена зеаксантинэпоксидазы Chlamydomonas значительно увеличивает количество каротиноидов, необходимых для предотвращения дегенерации желтого пятна (Baek et al., 2018). Модифицированный штамм водорослей использовали в качестве добавки к корму для цыплят, чтобы увеличить содержание зеаксантина в яйцах. Множество потенциальных применений для производства микроводорослей в космическом полете оправдывают прямое исследование генов, необходимых для производства жидких культур. Наше текущее исследование показывает как осуществимость эксперимента космического полета, так и идентификацию ряда генов обработки клеточной информации, которые, вероятно, необходимы хламидомонадам для адаптации к периодической культуре в воздухопроницаемых пластиковых пакетах.

Заявление о доступности данных

Полногеномные последовательности, созданные для этого исследования, можно найти в базе данных GeneLab https://genelab-data.ndc.nasa.gov/genelab/accession/GLDS-265/.

Вклад авторов

JZ, BR, KT, HH, FB и AS разработали и осуществили периодическую культуру и мутагенез. JZ построила библиотеки полногеномного секвенирования и провела предварительную обработку данных. BM, YH, MR и AS завершили анализ и интерпретацию последовательности генома.А.С., Дж.З. и Б.М. написали рукопись. Все авторы просмотрели и согласны с содержанием рукописи.

Финансирование

Эта работа финансировалась Центром развития науки в космосе (в настоящее время Международная космическая станция, Национальная лаборатория США), номер гранта GA-2017-254, номер гранта Флоридского космического института UCF01-0000381921, проект Национального института продовольствия и сельского хозяйства. номер FLA-HOS-005468 и фонд Vasil-Monsanto Endowment.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы благодарим Мэтью Хоффмана и Николь Дюфур за организацию EVT на объекте Veggie Космического центра Кеннеди и Николь С. Бейзел за техническую помощь.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fpls.2020.00631/full#supplementary-material

.

Сноски

Каталожные номера

Ай, В., Го, С., Цинь, Л., и Тан, Ю. (2008). Разработка наземного космического фотобиореактора с микроводорослями. Доп. Космический Рез. 41, 742–747. doi: 10.1016/j.asr.2007.06.060

Полнотекстовая перекрестная ссылка | Академия Google

Пэк, К., Ю, Дж., Чон, Дж., Сим, С.Дж., Бэ, С. и Джин, Э. (2018). Фотоавтотрофная продукция макулярного пигмента в штамме Chlamydomonas reinhardtii , полученном с использованием мутагенеза, опосредованного CRISPR-Cas9 RNP без ДНК. Биотехнология. биоинж. 115, 719–728.дои: 10.1002/бит.26499

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бансал, В. (2010). Статистический метод обнаружения вариантов путем повторного секвенирования пулов ДНК следующего поколения. Биоинформатика 26, i318–i324. doi: 10.1093/биоинформатика/btq214

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Bansal, V., Tewhey, R., Leproust, E.M., and Schork, N.J. (2011). Эффективное и экономичное повторное секвенирование популяции путем объединения и гибридизации в растворе. PLoS One 6:e18353. doi: 10.1371/journal.pone.0018353

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Брешиньяк, Ф., и Шиллер, П. (1992). Пилотный проект CELSS на основе выделяющего мальтозу Chlorella : концепция и обзор технологических разработок. Доп. Космический Рез. 12, 33–36. дои: 10.1016/0273-1177(92)

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бретшнайдер Дж., Белз С., Helisch, H., Detrell, G., Keppler, J., Fasoulas, S., et al. (2016). «Функциональность и установка эксперимента ISS на основе водорослей», в Proceedings of the 46th International Conference on Environmental Systems (Вена: Международная конференция по экологическим системам, Inc).

Академия Google

Буоно С., Лангелотти А. Л., Мартелло А., Ринна Ф. и Фольяно В. (2014). Функциональные ингредиенты из микроводорослей. Функц. 5, 1669–1685. дои: 10.1039/c4fo00125g

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Капорньо, М. П., и Матис, А. (2018). Тенденции включения микроводорослей в инновационные пищевые продукты с потенциальной пользой для здоровья. Перед. Нутр. 5:58. doi: 10.3389/fnut.2018.00058

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Cingolani, P., Platts, A., Wang, L.L., Coon, M., Nguyen, T., Wang, L., et al. (2012). Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов SnpEff: SNP в геноме Drosophila melanogaster штамма w1118; изо-2; изо-3. Муха 6, 80–92. doi: 10.4161/fly.19695

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

ДеПристо, М.А., Бэнкс, Э., Поплин, Р., Гаримелла, К.В., Магуайр, Дж.Р., Хартл, К., и соавт. (2011). Основа для обнаружения вариаций и генотипирования с использованием данных секвенирования ДНК следующего поколения. Нац. Жене. 43, 491–498. doi: 10.1038/ng.806

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Форбс, С.А., Беар, Д., Бутселакис, Х., Bamford, S., Bindal, N., Tate, J., et al. (2017). COSMIC: генетика соматического рака в высоком разрешении. Рез. нуклеиновых кислот. 45, Д777–Д783. doi: 10.1093/нар/gkw1121

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Галлахер, С. Д., Фитц-Гиббон, С. Т., Глезенер, А. Г., Пеллегрини, М., и Мерчант, С. С. (2015). Ресурс генома Chlamydomonas для лабораторных штаммов выявляет мозаику изменчивости последовательностей, идентифицирует истинную историю штаммов и позволяет проводить исследования конкретных штаммов. Растительная клетка 27, 2335–2352. doi: 10.1105/tpc.15.00508

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гао, З., Мурджани, П., Сасани, Т. А., Педерсен, Б. С., Куинлан, А. Р., Джорде, Л. Б., и соавт. (2019). Упущенная из виду роль повреждения ДНК и возраста матери в возникновении мутаций зародышевой линии человека. Проц. Натл. акад. науч. США 116, 9491–9500. doi: 10.1073/pnas.19116

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Гарнизон, Э.и Март, Г. (2012). Обнаружение вариантов на основе гаплотипов с помощью короткого секвенирования. arXiv.org [[Препринт].

Академия Google

Giardi, M., Rea, G., Lambreva, M., Antonacci, A., Pastorelli, S., Bertalan, I., et al. (2013). Мутации белка Photosystem II D1, которые обеспечивают эффективные фенотипы Chlamydomonas reinhardtii в экстремальных условиях космоса. PLoS One 8:e64352. doi: 10.1371/journal.pone.0064352

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Горман, Д.С. и Левин, Р. П. (1965). Цитохром f и пластоцианин: их последовательность в фотосинтетической цепи переноса электронов Chlamydomonas reinhardi . Проц. Натл. акад. науч. США 54, 1665–1669. doi: 10.1073/pnas.54.6.1665

Полнотекстовая перекрестная ссылка | Академия Google

Guo, J., Han, N., Zhang, Y., Wang, H., Zhang, X., Su, L., et al. (2015). Использование секвенирования генома для оценки вариаций структуры нуклеотидов штаммов Staphylococcus aureus , культивируемых в космическом полете на Шэньчжоу-X, в моделируемой микрогравитации и на Земле. Микробиолог. Рез. 170, 61–68. doi: 10.1016/j.micres.2014.09.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хелиш, Х., Кепплер, Дж., Детрелл, Г., Белз, С., Эвальд, Р., Фасулас, С., и соавт. (2019). Долгосрочное культивирование с высокой плотностью Chlorella vulgaris SAG 211-12 в новом фотобиореакторе с мембраной, способном работать в условиях микрогравитации, для будущего биорегенеративного жизнеобеспечения в космосе. Науки о жизни. Космический Рез. 24, 91–107. дои: 10.1016/ж.лсср.2019.08.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Катагири, М., Сато, А., Цудзи, С., и Ширасава, Т. (2012). Влияние богатого астаксантином экстракта Haematococcus pluvialis на когнитивную функцию: рандомизированное двойное слепое плацебо-контролируемое исследование. Дж. Клин. Биохим. Нутр. 51, 102–107. doi: 10.3164/jcbn.D-11-00017

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Киндл, К. Л., Шнелл, Р.А., Фернандес, Э., и Лефевр, П.А. (1989). Стабильная ядерная трансформация Chlamydomonas с использованием гена Chlamydomonas нитратредуктазы. J. Cell Biol. 109, 2589–2601. doi: 10.1083/jcb.109.6.2589

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Клифуйс, А. М., Клок, А. Дж., Мартенс, Д. Э., Ламерс, П. П., Янссен, М., и Вийффелс, Р. Х. (2012). Метаболическое моделирование Chlamydomonas reinhardtii : потребность в энергии для фотоавтотрофного роста и поддержания. J. Appl. Фикол. 24, 253–266. doi: 10.1007/s10811-011-9674-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ку, К.М., Юнг, С., Ли, Б.С., Ким, Дж.Б., Джо, Ю.Д., Чой, Х.И., и соавт. (2017). Механизм избыточного накопления крахмала у высококрахмальных мутантов Chlamydomonas reinhardtii идентифицирован с помощью сравнительного анализа транскриптома. Перед. микробиол. 8:858. doi: 10.3389/fmicb.2017.00858

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ли, Х.(2013). Выравнивание прочтений последовательностей, последовательностей клонирования и контигов сборки с помощью BWA-MEM. arXiv.org [Препринт].

Академия Google

Лю Х., Луо К., Цао Ю., Гулетт Т. и Сяо Х. (2016). Механизм различных стереоизомерных астаксантинов в устойчивости к окислительному стрессу у caenorhabditis elegans. J. Food Sci. 81, h3280–h3287. дои: 10.1111/1750-3841.13417

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Масса, Г.Д., Уилер, Р. М., Морроу, Р. К., и Левин, Х. Г. (2016). «Камеры выращивания на Международной космической станции для крупных растений», в материалах VIII Международного симпозиума по освещению в садоводстве , , Vol. 1134, ред. CJ Currey, RG Lopez и ES Runkle (Бельгия: ISHS Acta Horticulturae), 215–222. doi: 10.17660/ActaHortic.2016.1134.29

Полнотекстовая перекрестная ссылка | Академия Google

Матула, Э. Э., и Набити, Дж. А. (2019). Виды отказов, причины и последствия водорослевых фотобиореакторов, используемых для контроля среды космического корабля. Науки о жизни. Космический Рез. 20, 35–52. doi: 10.1016/j.lssr.2018.12.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Маккенна А., Ханна М., Бэнкс Э., Сиваченко А., Цибульскис К., Керницкий А. и др. (2010). Набор инструментов для анализа генома: структура mapreduce для анализа данных секвенирования ДНК нового поколения. Рез. генома. 20, 1297–1303. doi: 10.1101/гр.107524.110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Торговец, С.С., Прочник С.Е., Валлон О., Харрис Э.Х., Карпович С.Дж., Витман Г.Б. и соавт. (2007). Геном Chlamydomonas раскрывает эволюцию ключевых функций животных и растений. Наука 318, 245–250. doi: 10.1126/science.1143609

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мергенхаген Д. и Мергенхаген Э. (1989). Выражение циркадного ритма у двух штаммов Chlamydomonas reinhardii в пространстве. Доп.Космический Рез. 9, 261–270. дои: 10.1016/0273-1177(89)-3

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мурбах, Т.С., Главиц, Р., Эндрес, Дж.Р., Хирка, Г., Вертеси, А., Береш, Э., и др. (2018). Токсикологическая оценка Chlamydomonas reinhardtii , зеленых водорослей. Междунар. Дж. Токсикол. 37, 53–62. дои: 10.1177/1091581817746109

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нельсон, К.В., Монкла, Л.Х. и Хьюз, А.Л. (2015). SNPGenie: оценка параметров эволюции для обнаружения естественного отбора с использованием объединенных данных секвенирования следующего поколения. Биоинформатика 31, 3709–3711. doi: 10.1093/биоинформатика/btv449

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Newman, S.M., Boynton, J.E., Gillham, N.W., Randolph-Anderson, B.L., Johnson, A.M., и Harris, E.H. (1990). Трансформация генов рибосомной РНК хлоропластов у Chlamydomonas : молекулярно-генетическая характеристика интеграционных событий. Генетика 126, 875–888.

Реферат PubMed | Академия Google

Нидервизер Т., Коциолек П. и Клаус Д. (2018). Окружающая среда кабины космического корабля влияет на рост и поведение Chlorella vulgaris для приложений жизнеобеспечения. Науки о жизни. Космический Рез. 16, 8–17. doi: 10.1016/j.lssr.2017.10.002

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нислоу, К., Ли, А.Ю., Аллен, П.Л., Гиавер, Г., Смит, А., Геббиа М. и др. (2015). Гены, необходимые для выживания в условиях микрогравитации, выявлены с помощью полногеномных делеционных коллекций дрожжей, культивируемых во время космического полета. Биомед. Рез. Междунар. 2015:976458. дои: 10.1155/2015/976458

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Оцука Т., Симадзава М., Иноуэ Ю., Накано Ю., Оджино К., Идзава Х. и др. (2016). Астаксантин защищает сетчатку от повреждения: данные моделей ишемии и реперфузии сетчатки in vivo и in vitro. Курс. Глаз Res. 41, 1465–1472. дои: 10.3109/02713683.2015.1127392

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Паннунцио, Н. Р., Ватанабэ, Г., и Либер, М. Р. (2018). Негомологичное соединение концов ДНК для восстановления двухцепочечных разрывов ДНК. Дж. Биол. хим. 293, 10512–10523. doi: 10.1074/jbc.TM117.000374

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Салем, Н., и Эггерсдорфер, М. (2015). Достаточно ли мировых запасов омега-3 жирных кислот для оптимального питания человека? Курс.мнение клин. Нутр. Метаб. Уход 18, 147–154. doi: 10.1097/MCO.0000000000000145

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шах М.М., Лян Ю., Ченг Дж.Дж. и Дарох М. (2016). Вырабатывающая астаксантин зеленая микроводоросль Haematococcus pluvialis : от одноклеточных до ценных коммерческих продуктов. Перед. Растениевод. 7:531. doi: 10.3389/fpls.2016.00531

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Смолл, Г.(1987). Системы репарации ядерной и хлоропластной ДНК в Chlamydomonas reinhardtii . Мутат. Рез. 181, 31–35. дои: 10.1016/0027-5107(87)

-3

Полнотекстовая перекрестная ссылка | Академия Google

Тянь, Т., Лю, Ю., Ян, Х., Ю, К., Йи, X., Ду, З., и др. (2017). agriGO v2.0: набор инструментов для анализа GO для сельскохозяйственного сообщества, обновление 2017 г. Рез. нуклеиновых кислот. 45, W122–W129. doi: 10.1093/nar/gkx382

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван, Г., Chen, H., Li, G., Chen, L., Li, D., Hu, C., et al. (2006). Рост популяции и физиологические особенности микроводорослей в миниатюрном биореакторе во время космического полета. Акта Астронавт. 58, 264–269. doi: 10.1016/j.actaastro.2005.11.001

Полнотекстовая перекрестная ссылка | Академия Google

Ван, X., Виллен, Р., и Вадстрем, Т. (2000). Богатая астаксантином мука из водорослей и витамин С ингибируют инфекцию Helicobacter pylori у мышей BALB/cA. Антимикроб. Агенты Чемотер. 44, 2452–2457. doi: 10.1128/AAC.44.9.2452-2457.2000

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Wilm, A., Aw, P.P., Bertrand, D., Yeo, G.H., Ong, S.H., Wong, C.H., et al. (2012). LoFreq: сверхчувствительный вызывающий вариант, учитывающий качество последовательности, для выявления неоднородности клеточной популяции из наборов данных высокопроизводительного секвенирования. Рез. нуклеиновых кислот. 40, 11189–11201. doi: 10.1093/nar/gks918

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сюй, Л., Ченг, X., и Ван, К. (2018). Повышенное производство липидов у Chlamydomonas reinhardtii при совместном культивировании с Azotobacter chroococcum . Перед. Растениевод. 9:741. doi: 10.3389/fpls.2018.00741

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Селективное разведение пресноводной микроводоросли Chlamydomonas reinhardtii для повышения солености

Увеличение антропогенной деятельности привело к повышенному уровню загрязнения, поступающего в водные системы.Эти чрезмерные концентрации тяжелых металлов, азота (N) и фосфора (P) в водоемах могут привести к ряду неблагоприятных воздействий, таких как эвтрофикация и риски для здоровья человека. Поэтому удаление загрязняющих веществ из сточных вод до их сброса в природную среду имеет первостепенное значение. Однако традиционные технологии очистки сточных вод (ОСВ) имеют свои ограничения; например, большие капитальные/эксплуатационные затраты и неполное удаление загрязняющих веществ. Поэтому необходимы инновационные и более эффективные технологии лечения.Макроводоросли обычно имеют высокие скорости роста и преобразования солнечной энергии, а также способны улавливать питательные вещества, утилизировать CO2 и поглощать металлы из водной среды. Следовательно, водоросли могут иметь потенциальное применение в WWT. Кроме того, затраты могут быть сведены на нет за счет производства возобновляемой биомассы водорослей, которая может иметь множество коммерческих применений. Однако такие проблемы, как неправильный выбор видов или систем культивирования, а также непонимание влияния биологических, химических и физических факторов, особенно в высокодинамичных средах сточных вод, привели к различным результатам и не позволили водорослевым водорослям стать широко распространенной реальностью. .В этой диссертации водоросли Cladophora coelothrix и Cladophora parriaudii изучались как потенциальные организмы для внедрения в WWT. В дополнение к упомянутым выше характеристикам Cladophora была выбрана из-за ее повсеместного распространения, нитевидной морфологии, которая сводит к минимуму затраты на сбор урожая, а также их естественного доминирования и поведения при формировании цветения в среде, богатой питательными веществами. Оценивали влияние методов обезвоживания, факторов окружающей среды и режима питания на рост, удаление питательных веществ/металлов и биохимический состав биомассы.Первым аспектом диссертации был процесс абиотического скрининга, чтобы исследовать устойчивость Cladophora и ее пригодность для приложений WWT на фундаментальном уровне. Хорошие темпы роста (4-13,3% d-1) и удаления питательных веществ (45,2-99,9%) наблюдались на протяжении всего процесса скрининга, за исключением самых экстремальных условий, например. pH 3. Это указывает на то, что Cladophora потенциально подходят для очистки широкого спектра сточных вод и заслуживают дальнейших исследований для улучшения их потенциальной применимости для применения в очистных сооружениях и коммерческой реализации.Например, разработка надежного и точного метода оценки сырого веса (FW) и, следовательно, оценки продуктивности. Определение скорости роста с помощью измерения FW является одним из самых основных аспектов биологии водорослей, однако стандартного метода для нитчатых макроводорослей не существует. Различные методы FW систематически оценивались с точки зрения точности и физиологического воздействия. Методы, включающие механическое прессование для обезвоживания биомассы, привели к снижению конечного выхода биомассы более чем на 25% по сравнению с контрольными культурами.В лучшем методе определения FW использовалась сетчатая блесна, которая была быстрой, надежной и легко стандартизируемой. Кроме того, этот подход обеспечивал точную оценку роста с минимальным физиологическим воздействием, измеряемым ростом, сохранением структурной целостности и удалением питательных веществ. Это указывает на то, что разработанный метод имеет потенциал для широкого применения при культивировании макроводорослей, поскольку он использовался в данной диссертации. Влияние режима питания на рост, биохимический состав и способность к биоремедиации было изучено для обоих видов Cladophora.Испытанные режимы питательных веществ, характерные для широкого спектра сточных вод, включали четыре различных соотношения N/P, четыре источника азота (аммоний, нитрат, нитрит и мочевина) и шесть различных комбинаций эквимолярных источников азота, обеспечиваемых при двух соотношениях N/P. Были явные различия в производительности между двумя видами, при этом более высокие темпы роста наблюдались во всех случаях у C. parriaudii (4,75-11,2% d-1 против 3,98-7,37% d-1). Кроме того, аммоний удалялся предпочтительно, тогда как мочевина удалялась вторично.Однако присутствие мочевины в среде усиливало рост и поглощение других сосуществующих N-форм и давало биомассу, богатую углеводами (37,6-54% DW). Эти результаты показывают, что выбор штамма водорослей важен для очистки сточных вод с определенным профилем питательных веществ. Кроме того, результаты этого исследования показывают, что режимы питательных веществ могут быть адаптированы для производства биомассы с определенными свойствами или характеристиками, которые делают ее пригодной для дальнейших, потенциально рентабельных применений, таких как биосорбция металлов.Поскольку было показано, что на биохимические характеристики биомассы водорослей влияет режим питательных веществ, в последней главе описываются исследования, изучающие влияние истории питания на биосорбцию металлов. C. parriaudii выращивали при различных режимах питательных веществ для получения биомассы различного биохимического состава. Эта биомасса затем использовалась для удаления металлов с максимальными скоростями удаления в диапазоне 1,08-2,35 ммоль/г, 0,3-0,62 ммоль/г, 0,22-0,48 ммоль/г и 0,43-0,61 ммоль/г для Al2+, Cu2+, Mn2+ и Pb2+ соответственно.Наблюдения в этой работе показывают, что удаление металлов достигается различными механизмами, включая адсорбцию, ионный обмен, комплексообразование и микроосаждение, и что эффективность биосорбции зависит от количества и типа присутствующих функциональных групп, на которые, в свою очередь, влияют культуры. питательный режим. В целом, это исследование демонстрирует взаимосвязь биологических, химических и физических факторов с ростом водорослей, удалением питательных веществ, биохимическим составом и биосорбцией металлов.Результаты этой работы выявили необходимость стандартизации протоколов, более глубокое понимание влияния отбора водорослей и характеристик питательных веществ на биоремедиацию, а также подчеркнули важность учета биологических аспектов, особенно истории питания, в исследованиях биосорбции.

Нокаут двух генов без ДНК у Chlamydomonas reinhardtii с помощью рибонуклеопротеинов CRISPR-Cas9

Культивирование клеток

Chlamydomonas reinhardtii штаммы CC-4349 cw15 mt- и мутантные штаммы культивировали и поддерживали ранее, как описано 17 20 80 90Вкратце, клетки поддерживали при 25°C под непрерывным белым светом при слабом освещении (50 мкмоль фотонов м -2  с -1 ). Клетки культивировали фотогетеротрофно в среде трис-ацетатфосфат (TAP) или фотоавтотрофно в среде с высоким содержанием солей (HS) при непрерывном низком и высоком освещении (50 и 700 мкмоль фотонов м -2  с -1 соответственно). Данные во всех экспериментах указывают на среднее значение и SE по меньшей мере из трех биологических повторностей.

Препарат РНК

Очищенный рекомбинантный белок Cas9 был приобретен у ToolGen, Inc.Направляющую РНК транскрибировали in vitro с использованием набора MEGAshortscript T7 (Ambion), как описано ранее 9. Транскрибированную РНК очищали экстракцией фенолом:хлороформом, экстракцией хлороформом и осаждением этанолом. Очищенную РНК количественно определяли спектрометрией.

Chlamydomonas Преобразование Chlamydomonas Для генерации

Для генерации Mutrates Comment-Special Consuctout используют комплекс RNP в Chlamydomonas , 50 × 10 4 клетки были преобразованы с помощью белка Cas9 (200 мкг) с in vitro транскрибированные SGRA (140 мкг ).Белок Cas9 в буфере для хранения (20 мМ HEPES pH 7,5, 150 мМ KCl, 1 мМ DTT и 10% глицерина) смешивали с sgRNA, растворенной в воде, не содержащей нуклеаз, и инкубировали в течение 10 минут при комнатной температуре. Клетки трансформировали с помощью систем электропорации Biorad Gene Pulser Xcell™ в соответствии с рекомендованным протоколом из набора GeneArt Chlamydomonas Engineering. После трансформации клетки инкубировали в течение 12 часов и собирали для выделения геномной ДНК или сразу же разбавляли количество клеток до 2000 и высевали на среду ТАР, содержащую 1.5% агар для получения одиночных колоний для дальнейшего исследования (дополнительная рис. 14).

Целевое глубокое секвенирование

Сегменты геномной ДНК, охватывающие сайты-мишени нуклеазы, амплифицировали с использованием полимеразы Phusion (New England Biolabs). Равные количества ампликонов ПЦР подвергали секвенированию считывания парных концов с использованием Illumina MiSeq. Редкие чтения последовательности, которые происходят только один раз, были исключены, чтобы устранить ошибки, связанные с реакцией секвенирования и амплификации. Инделы, расположенные вокруг сайта расщепления RGEN (3 bp выше PAM), считались мутациями, индуцированными RGEN.Данные глубокого секвенирования доступны в архиве чтения последовательностей NCBI (www.ncbi.nlm.nih.gov/sra) под номером доступа PRJNA327012.

Исследование потенциальных нецелевых сайтов

Чтобы проверить наличие нуклеаз-индуцированных вставок в сотнях тысяч потенциальных нецелевых сайтов в каждой последовательности генома, мы использовали Cas-OFFinder 23 для составления списка потенциальных нецелевых сайтов которые отличались от сайтов-мишеней до 4 нуклеотидов или которые отличались до 2 нуклеотидов с выпуклостью ДНК или РНК по длине.В результате было получено 17 потенциальных нецелевых сайтов, и мы провели целенаправленное глубокое секвенирование в независимых клонах.

Генотипическая характеристика

Геномную ДНК экстрагировали из клеток, собранных после трансформации, или из отдельных колонизированных мутантов, отобранных из чашки с агаром ТАР, для целенаправленного глубокого секвенирования и секвенирования по Сэнгеру, соответственно. Для выделения геномной ДНК клетки собирали, ресуспендировали в буфере для микропрепаратов, содержащем 2,5× экстрактный буфер (0.35 M сорбита, 0,1 M Tris/HCl pH 7,5 и 5 mM EDTA), 2,5× буфера для лизиса ядер (0,2M Tris/HCl pH 7,5, 0,05M EDTA, 2 M NaCl и 2% (w/v) CTAB) и 1 × 5% N-лауроилсаркозина и инкубировали в течение 2 часов при 65 °C. Геномную ДНК экстрагировали смесью хлороформ:изоамиловый спирт 24:1 и осаждали изопропанолом. Для секвенирования по Сэнгеру целевые области были амплифицированы методом ПЦР со специфическими праймерами (дополнительная таблица 2). Продукты ПЦР проверяли электрофорезом в агарозном геле, элюировали из геля и секвенировали методом Сэнгера (Macrogen, Южная Корея).

Отбор мутантов

Целевые нокаутные мутанты были отобраны на основе окраски клеток и измерения флуоресценции хлорофилла (Хл) с помощью системы Walz image-PAM Система флуоресценции хл серии M, оснащенная ПЗС-камерой, как описано . У первоначально скринированных трансформантов измеряли пигменты для проверки их измененных составов пигментов.

Определение пигментов и фотосинтетической активности

Клетки для определения пигментов выращивали в условиях низкой освещенности, 50 мкмоль фотонов м −2  с −1 .Содержание Chl в клетках определяли спектрофотометрически в 80% (об./об.) ацетоновых экстрактах, как описано 26,27 . ВЭЖХ-анализ проводили с помощью модели LC-20AD для ВЭЖХ Shimadzu Prominence, оснащенной картриджной колонкой Waters Spherisorb 5,0 мкм ODS1 4,6×250 мм. Пигмент экстрагировали 90% (об./об.) ацетоном и супернатант образца подвергали анализу ВЭЖХ. Пигменты разделяли с использованием смеси растворителей 0,1 М Трис-HCl pH 8,0, ацетонитрила, метанола и этилацетата.Во время цикла концентрации растворителя составляли 14% 0,1 М Трис-HCl, 84% ацетонитрила и 2% метанола от 0 до 15 минут. От 15 до 19 минут смесь растворителей состояла из 68% метанола и 32% ацетонитрила. Последующий цикл проводили в течение 6 минут с исходной смесью растворителей. Скорость потока была постоянной и составляла 1,2 мл в минуту. Пигменты были обнаружены при 445 нм и 670 нм. Концентрацию отдельного пигмента определяли по профилям ВЭЖХ, откалиброванным по стандартным пигментам хлорофилла и каротиноидов (14C Centralen; DHI, Hørsholm, Дания).Фотосинтетическую активность измеряли при 25 °C кислородным электродом типа Hansatech Clark, освещенным галогенной лампой. Аликвоту 1 мл суспензии клеток, содержащую 2 мкМ Хл, переносили в камеру кислородного электрода. Чтобы гарантировать, что выделение кислорода не ограничивается поступлением углерода в клетки, перед измерениями к суспензии добавляли 50 мкл 0,5 М NaHCO 3 , pH 7,4. Выделение кислорода измеряли при увеличении интенсивности света, от 0 до 1200 мкмоль фотонов м -2  с -1 , и каждый шаг регистрировали в течение 2 минут.

SDS-PAGE и вестерн-блот-анализ

Для анализа белков клетки, выращенные в ТАР при 70 мкмоль фотонов м –2  с –1 , собирали, ресуспендировали в лизирующем буфере (20 мМ HEPES-KOH pH 7,5, 5 мМ MgCl 2 , 5 мМ β-меркаптоэтанола и 1 мМ PMSF) и разрушали ультразвуком. Образцы общего белка загружали и разделяли на гель SDS-PAGE, как описано26. Гели SDS-PAGE окрашивали 0,1% (масса/объем) кумасси бриллиантового синего R для визуализации или наносили на мембрану ATTO P PVDF с помощью системы полусухого переноса.Мембраны исследовали с помощью специфических поликлональных антител, вырабатываемых против зеаксантинэпоксидазы (ZEP), cpFTSY и β-субъединицы АТФ-синтазы (ATPβ) из C. reinhardtii . Сигналы визуализировали с использованием реагента ECL Abfrontier west save up и подвергали воздействию рентгеновской пленки для обнаружения сигнала.

Анализ роста

Клетки Chlamydomonas выращивали фотоавтотрофно в 200 мл среды HS в фотобиореакторе с барботажной колонкой (диаметром 40 мм и высотой 500 мм), освещенном непрерывным сильным светом (700 мкмоль фотонов м -2 8 −1 ) при 25 °C.Каждую культуру аэрировали 5% CO 2 при скорости подачи 40 мл/мин. Начальная концентрация клеток для каждой культуры составляла 100 × 10 4 клеток/мл.

Опосредованная агробактериями и электропорация трансформация Chlamydomonas reinhardtii: сравнительное исследование | BMC Биотехнология

Штаммы Chlamydomonas и условия культивирования

Штаммы Chlamydomonas reinhardtii cw15 с дефицитом клеточной стенки и штаммы CC125 (+) с клеточной стенкой [24] использовались во всех экспериментах.Клетки выращивали фотомиксотрофно в среде трис-ацетат-фосфат (TAP) [24] при 25 °C при непрерывном облучении флуоресцентным белым светом (60 мкЭ м - 2 с - 1 ). В случае штамма cw15 в среду для выращивания добавляли 1% ( w / v ) D-сорбита.

Для анализа люциферазы трансформанты выращивали в 1,5 мл среды TAP при 160 об/мин при 80 мкЕ·м − 2 с −1 на ротационном шейкере до тех пор, пока они не достигали стационарной фазы (около 48 ч) за 24 – колодезные блоки (Qiagen, кат.н. 19 583). Затем культуры разбавляли 1:20 в 4 мл среды ТАР и выращивали в течение 48 часов. Планшеты покрывали мембраной Breathe-Easy (Sigma-Aldrich, каталожный номер Z763624-100EA) для предотвращения испарения без ограничения газо- и светообмена. Осадок замороженных клеток по 200 мкл каждой культуры повторно суспендировали в 40 мкл буфера для лизиса (Система анализа люциферазы Renilla, Promega, кат. E2820), лизировали при комнатной температуре в течение 15 минут на роторном шейкере (750 об/мин), а затем инкубировали на льду до определения активности.Данные нормализовали, используя оптическое поглощение по крайней мере в двух биологических повторностях для каждого трансформанта.

Конструкция плазмиды

Для получения плазмид pAgroR (рис. 1, панель а) и pAgroL (карта не показана) pSL18 [25] расщепляли NotI и KpnI. В результате расщепления образуются два фрагмента длиной 3255 и 2867 п.н., которые были затуплены с использованием фрагмента Кленова (Roche, каталожный номер 11 008 404 001). Фрагмент размером 3255 п.н., содержащий экспрессионную кассету паромомицина и регуляторные элементы PSAD и терминатор, очищали в геле и использовали для следующего этапа клонирования.Плазмида pKCRTI [26] (полученная из pCAMBIA 1390) была расщеплена BglII и XhoI с высвобождением четырех фрагментов длиной 13, 865, 3391 и 6906 п.н. Расщепление подвергали заполнению по Кленоу, и фрагмент 6906 п.н., содержащий все генетические элементы, необходимые для размножения и переноса Agrobacterium в ядро ​​хозяина (включая LB и RB), очищали в геле. Два фрагмента размером 3255 п.н., происходящие из pSL18, и 6906 п.н., происходящие из pKCRTI, были клонированы тупым путем, и была проведена ПЦР с использованием специфических олигонуклеотидов для различения двух разных ориентаций фрагментов.Суффиксы R и L в векторах pAgro относятся к положению пустой экспрессионной кассеты PSAD по отношению к границам (R: кассета PSAD близка к RB; L: кассета PSAD близка к LB). ). Для создания плазмид pAgroLucR и pAgroLucL кодирующую последовательность люциферазы Renilla reniformis выделяли методом ПЦР из плазмиды PSAD :cRLuc [27] со следующими олигонуклеотидами: crLuc-EcoRI for CAGC GAATTC ATGGCCAGCAAGGrev TCTAGA TTACGTATCGTTCTTCAGC (сайты рестрикции EcoRI и XbaI выделены жирным шрифтом, специфическая последовательность гена выделена курсивом).Затем продукт ПЦР клонировали EcoRI-XbaI в pAgroR и pAgroL с образованием соответственно pAgroLucR и pAgroLucL (рис. 1, панель b и c). Бактериальный штамм, использованный для клонирования, представлял собой XL1Blue от Statagene. Бактериальную трансформацию осуществляли методом электропорации.

Экстракция ДНК из клеток

Chlamydomonas и ПЦР-анализ

Отдельные колонии клеток Chlamydomonas собирали и ресуспендировали в 200 мкл 5% раствора ( w / v v )-chelexdrich (S.Alexdrich, Cat.Alexdrich, S.Alexdrich).н. C7901-25G) в 96-луночном планшете. Планшет инкубировали 10 мин при 100 °C, 10 мин на льду и центрифугировали при 6000 g в течение 3 мин. Один микролитр супернатанта использовали для проведения ПЦР-анализа. Последовательности олигонуклеотидов, использованные для скрининга трансформантов Chlamydomonas , представлены в дополнительном файле 7: Таблица S1. β-тубулин использовали в качестве положительного контроля для выделения ДНК, олигонуклеотиды паромомицина использовали для скрининга положительности к антибиотику, олигонуклеотиды канамицина использовали для оценки остаточной контаминации Agrobacterium , а cRLuc для 710 и PSAD Ter 276 использовали для проверки наличие гена люциферазы.

Колонии Chlamydomonas были проанализированы с помощью ПЦР после трех пересевов на чашку с 1,5% TAP-агаром, содержащую 10 мкг/мкл парамомицина. В случае трансформантов Chlamydomonas , полученных методом совместного культивирования, добавляли 500 мкг/мкл цефотаксима и 500 мкг/мкл карбенициллина для удаления остаточных клеток Agrobacterium . Девяносто шесть колоний анализировали с помощью ПЦР для каждого эксперимента по трансформации.

Chlamydomonas электропорация

Клетки Chlamydomonas культивировали в среде TAP до 3–6 × 10 6 клеток/мл, а затем центрифугировали при 3000 g в течение 5 мин при 4 °C.Осадок однократно промывали холодным ТАР, содержащим 60 мМ D-сорбита, и ресуспендировали при конечной концентрации 2 × 10 8 клеток/мл. 250 мкл (5 × 10 7 клеток) этой культуры смешивали с 200 нг линеаризованного вектора в кювете 0,4 см (BIORAD, кат. номер 165–2081) и подвергали электропорации при 25 мкФ, 2000 В/см . Постоянная времени находилась в диапазоне от 13 до 16 мс. Электропорированные клетки восстанавливали в течение ночи в среде ТАР при слабом освещении (30 мкЕ м - 2 с - 1 ), а затем высевали на чашку с 1% агара ТАР, содержащую 10 мкг/мкл парамомицина в случае векторов, описанных на фиг.1. Для электропорации вектор pAgroLucR (рис. 1b) линеаризовали с помощью AgeI. Было проведено два независимых эксперимента по электропорации, для каждой электропорации проведено десять трансформаций. Девяносто шесть трансформантов для каждой трансформации анализировали с помощью ПЦР.

Трансформация, опосредованная Agrobacterium-, с использованием опубликованных методов

В первой серии экспериментов клеток Chlamydomonas трансформировали в соответствии с [28].Вкратце, клетки LBA4404 (Takara, кат. № 9115) и C58C1 Agrobacterium , любезно предоставленные профессором Эдгардо Филиппоне, трансформировали посредством электропорации вектором pAgroR (рис. 1, панель а) и высевали на LB, содержащую 100 мкг/ мл канамицина и 100 мкг/мл рифампицина (штамм LBA4404) или 200 мкг/мл канамицина и 100 мкг/мл рифампицина (штамм C58C1) и выращивали в течение 48 часов при 28 °C. Пять одиночных колоний из каждого планшета для трансформации инокулировали в 1,5 мл среды LB, содержащей соответствующие антибиотики, и анализировали с помощью ПЦР для проверки наличия правой и левой границ со следующими парами олигонуклеотидов: PSAD Ter для GATTTCGCTGATTGATACGG и R border rev TAAACGCTCTTTTTTCTCTTAGG, производящий ампликон размером 894 п.н., L border для TGGCAGGATATTGTGGTG и Paro box rev CTGGACTGGGAGCGGTGT, производящий ампликон размером 1039 п.н.Все пять собранных колоний показали правильные ампликоны, и одна из них была инокулирована в среде LB с антибиотиками для приготовления глицериновых запасов. Для каждого эксперимента по трансформации 100 мкл исходного глицеринового раствора инокулировали в 15 мл жидкой среды YEB, содержащей 30 мкг/мл рифампицина и 100 мкг/мл канамицина, и выращивали в течение 24 часов при 28 °C. Затем клетки центрифугировали при 2700 g в течение 30 минут и ресуспендировали в жидкой среде TAP, содержащей 100 мкМ ацетосирингона, до A 595 0,5. 10 7 Клетки Chlamydomonas высевали на чашку Петри диаметром 90 мм и выращивали в течение двух дней при 80 мкЕ м - 2  с - 1 при постоянном освещении, чтобы обеспечить формирование газона клеток.200 мкл бактериальной суспензии, полученной, как описано выше, распределяли на газоне клеток Chlamydomonas для совместного культивирования. После совместного культивирования в течение 48 ч при 30 мкЕ м - 2 с - 1 клетки собирали при 1500 г в течение 5 мин, дважды промывали жидкой средой ТАР, содержащей 500 мкг/мкл цефотаксима, путем центрифугирования при 1500 г в течение 5 мин. Наконец, клетки ресуспендировали в TAP при концентрации 5 × 10 7 клеток/мл, а затем 1 мл высевали на чашки TAP с 1% агаром, содержащие 10 мкг/мкл парамомицина, 500 мкг/мкл цефотаксима и 500 мкг/мкл карбенициллина.Паромомицин является селективным антибиотиком для трансформации, в то время как цефотаксим и карбенициллин использовались для уничтожения клеток Agrobacterium . Одиночные колонии появились через 7 дней роста при 30 мкЕ м - 2 с - 1 . Эти колонии собирали и переносили на новые чашки с ТАР-агаром, содержащие все три антибиотика. Даже если бы мы могли наблюдать несколько колоний на чашке для первичной трансформации, после двух-трех пересевов на селективную среду они погибали, вероятно, из-за ложноположительных результатов или из-за того, что вектор не интегрировался стабильно в ядро.Во втором раунде экспериментов мы следовали протоколу, описанному в [7], но в этом случае мы не могли наблюдать никаких колоний на чашках первичной трансформации.

Разработка модифицированного протокола для трансформации, опосредованной

Agrobacterium-

Для разработки протокола трансформации Chlamydomonas через Agrobacterium в нашей лаборатории мы следовали указаниям [19]. Глицериновые запасы штаммов Agrobacterium LBA4404 и C58C1, трансформированных вектором pAgroR, полученным, как описано в предыдущем абзаце, инокулировали в 15 мл среды AB (pH 7) [29], содержащей 0.5% ( w / v ) глюкоза, 30 мкг/мл рифампицина и 100 мкг/мл канамицина. Колбы выращивали при 28 °C в течение 24 ч, затем центрифугировали при 2700 g в течение 30 мин и, наконец, ресуспендировали в 40 мл среды для индукции AB (среда AB, содержащая 0,5% глюкозы, 20 мкМ MES, pH 5,6, и 100 мкМ ацетосирингона). и выращивали в течение ночи при 28 °C. Перед совместным культивированием плотность клеток доводили до A 595  = 0,5 с помощью индукционной среды AB. Пятьдесят мл культуры Chlamydomonas , выращенной в течение 2 дней в среде ТАР при концентрации приблизительно 10 7 клеток/мл, центрифугировали при 1500 g в течение 5 мин и ресуспендировали в среде AB при конечной плотности клеток 10 8 клеток/мл.Для совместного культивирования 100 мкл микроводорослей, соответствующих 10 7 клеток, и 40 мкл Agrobacterium наносили на чашки со средой для индукции АВ с 1% агара. В общей сложности 14 пятен, соответствующих 10 8 клеток Chlamydomonas , высевали на каждую чашку с 1% агаровой средой для индукции AB, и чашки выращивали при 30 мкЕ м - 2 с - 1 в течение 48 часов. Затем клетки собирали с каждого планшета, дважды промывали жидкой средой ТАР, содержащей 500 мкг/мкл цефотаксима, центрифугировали при 1500 g в течение 5 мин, ресуспендировали в жидкой среде ТАР плотностью 5 × 10 7 клеток/мл и высевали. на двух чашках с агаром TAP, содержащих 10 мкг/мкл парамомицина, 500 мкг/мкл цефотаксима и 500 мкг/мкл карбенициллина.Через 1 неделю роста начали появляться колонии. Эффективность трансформации выражали как среднее число устойчивых к паромомицину колоний, полученных на 10 8 клеток Chlamydomonas .

Колонии, устойчивые к паромомицину, переносили для трех раундов пересева на чашки с 1,5% ТАР-агаром, содержащим селективные антибиотики, а затем анализировали с помощью ПЦР. Было проведено два независимых эксперимента по трансформации для каждого вектора, и 96 колоний для каждого эксперимента были проанализированы с помощью ПЦР.

Анализ люциферазы

Анализ люциферазы проводили с использованием системы Renilla Luciferase Assay System (Promega, кат. № E2820), как описано в [27]. Люминесценцию дикого типа (фоновую люминесценцию) вычитали из люминесценции трансформантов. Все трансформанты, демонстрирующие уровень активности Luc > 3 раза по сравнению с фоном, считались Luc-позитивными. Приведенные значения люминесценции относятся к 10 5 клеток. Для каждого трансформанта анализировали не менее двух биологических и двух технических повторностей.

Полногеномное секвенирование и биоинформатический анализ

Тотальную ДНК экстрагировали с помощью набора DNeasy Plant Mini Kit (Qiagen, кат. № 69104) из осадка, полученного из 8 мл культур со средней логарифмической фазой (концентрация 5 × 10 6 клеток /мл), выращенных в среде ТАР, как описано выше.

Качество и концентрацию ДНК проверяли, прогоняя образцы на 0,5% агарозном геле и флуорометрически (Qubit, ThermoFisher Scientific) соответственно. Для каждого образца был использован один микрограмм ДНК для создания библиотек Illumina с парными концами, которые затем были секвенированы на секвенаторе HiSeq 2500 Illumina с получением в среднем около 8 миллионов прочтений с парными концами.Риды очищали от адаптеров и обрезали по качеству с помощью Cutadapt v. 1.8.1 [30] и Trimmomatic v. 0.33 [31]. Составной эталон был подготовлен путем объединения генома Chlamydomonas reinhardtii v. 5.5 [32] и последовательности вектора pAgroLucR. Все библиотеки были сопоставлены с эталоном с использованием Bowtie2 v. 2.2.7 [33] в качестве отдельных концов, чтобы избежать какой-либо систематической ошибки из-за спаривания результатов сопоставления (дополнительный файл 7: таблица S5). Для выделения инсерционных сигналов оставляли только пары с попаданием как в геном водоросли, так и в вектор.Наконец, для каждого трансформированного образца все сигналы сравнивались с сигналами дикого типа, и точки вставки вызывались с помощью MACS v. 2.1.1 [34].

Поощрение штаммов Chlamydomonas к спариванию

От Боба Ходсона, июль 1995 г.

[email protected]

Я собрал воедино процедуры из различных источников (все личные сообщения) — Либ Харрис (также справочник), Пита Лефевра, Билла Снелла и Сьюзен Датчер — для спаривания Chlamy, которые обычно работают для нас и подходят для штаммов cw- и pf как а также штаммы с различными требованиями, такими как аргинин или никотинамид.Вероятно, есть много возможностей для модификации, например. среда, интенсивность света, температура и т. д.

1. Всегда имейте под рукой газоны на TAP (трис-ацетат-фосфат с 8 мМ аммония) с добавлением 0,4% дрожжевого экстракта, 2 мМ аргинина и 10 мМ MOPS (1,5% агара, если не указано иное) = «обогащенные чашки». ». рН составляет 6,8 и является результатом использования уксусной кислоты (1 мл на литр) вместо ацетата и дополнительного гидроксида натрия (около 1,4 мл 4М на литр). MOPS помогает контролировать pH. Трис имеет pK около 8, и с ним в качестве единственного буферного агента среда имеет тенденцию повышаться до этого значения и становиться токсичной.MOPS имеет pK около 7 (но в два раза дороже). Аргинин добавляется, чтобы обеспечить достаточное количество аргинина, и его можно не добавлять. Экстракт дрожжей обеспечивает добавки для некоторых «стандартных» картируемых штаммов (например, CC2645), а также помогает выявить загрязнение в культурах (но также способствует этому). Газоны выращивают при комнатной температуре (20С) при тусклом свете и готовы через 5 дней; другие условия температуры и освещения, вероятно, будут работать одинаково хорошо, но время роста будет соответственно различаться. Эти запасы заменяются каждые две недели, но могут быть полезны и дольше, особенно если используется MOPS.

2. Соскоблите примерно 1/3 газона и суспендируйте в 1,0 мл N-TAP (без MOPS или источника азота) в 24-луночной культуральной чашке. Разбейте комки повторным пипетированием. Используйте 0,5 мл, чтобы сделать газон клеток на N-TAP, содержащих 1 мМ аммония = «пластины с низким N». Инкубируйте 2 дня при 25°C при умеренном освещении (флуоресцентная лампа 2000 f-c). Даже arg- и nic-штаммы выживают и хорошо спариваются. Поместите оставшиеся 0,5 мл на насыщенные чашки, чтобы освежить запасы.

3. Соскоблите около 1/3 газона с низким содержанием азота и суспендируйте в 4 мл половинной концентрации N-TAP в колбе на 25 мл.Цель составляет около 2 миллионов клеток на мл. Встряхивайте на водяной бане при 25°С при ярком свете (2 прожектора по 150 Вт на расстоянии примерно 20 см) в течение 4 часов (двух часов может быть достаточно; активность спаривания снижается за ночь, но не до нуля).

4. Смешайте по 0,5 мл каждого типа спаривания в 1,5-мл стерильной пробирке Эппендорф. Инкубируйте стационарно при 25°С при ярком свете в течение соответствующего времени (см. ниже). Остальные пробирки в горлышках 25-мл конических колб, наполненных водой и промытых водой для контроля температуры. Подходящее время зависит от штаммов.Штаммы с очень активной стенкой, такие как CC124- и CC125+, можно высевать через час или два, а более длительная инкубация дает трудноразбиваемые комки. штаммы cw-, вероятно, также могут быть высеяны довольно скоро, если другие штаммы хорошо спариваются. Для штаммов pf дайте спариваться в течение часа, раскрутите клетки ровно настолько, чтобы образовался осадок (2000 об/мин, 1 мин), удалите большую часть среды, аккуратно встряхните клетки в оставшейся среде и дайте спариванию продолжаться еще от 3 часов до ночи, если это необходимо. . Тарелка порциями по 0,5 мл.

Подсказки зеленых водорослей о происхождении самцов и самок — ScienceDaily

Многоклеточная зеленая водоросль Volvox carteri , возможно, наконец-то раскрыла секреты эволюции разных полов.Группа исследователей из Института биологических исследований Солка показала, что генетический регион, определяющий пол у Volvox , резко изменился по сравнению с таковым у близкородственной одноклеточной водоросли Chlamydomonas reinhardtii .

Их результаты, которые будут опубликованы в выпуске журнала Science от 16 апреля, обеспечивают первую эмпирическую поддержку модели эволюции двух разных полов, согласно которой расширение области, определяющей пол, создает генетическое разнообразие, за которым следуют гены. о новых функциях, связанных с производством мужских и женских половых клеток, называемых гаметами.

«До сих пор определяющие пол хромосомы обычно рассматривались как участки распада, постепенно теряющие гены, не участвующие в половом размножении», — объясняет Джеймс Юмен, доктор философии, доцент Лаборатории молекулярной и клеточной биологии растений в Институт Солка, который руководил группой, проводившей исследование. «Наше исследование показывает обратное: такие области могут расширяться и генерировать новый генетический материал гораздо быстрее, чем остальная часть генома».

Большинство многоклеточных организмов, таких как растения и животные, имеют два разных пола: самки производят крупные неподвижные яйца, а самцы производят мелкие подвижные сперматозоиды.В то время как одноклеточные организмы также могут размножаться половым путем, два пола одноклеточных видов обычно неотличимы друг от друга и, как считается, представляют собой предковое или раннее эволюционное состояние. Однако большие расстояния, отделяющие растения или животных от их ближайших одноклеточных родственников, не позволили понять эволюционный переход к диморфизму самцов и самок.

«У одноклеточных организмов, таких как Chlamydomonas , гаметы выглядят одинаково.Напротив, многоклеточные организмы, в том числе Volvox , производят яйцеклетки и сперматозоиды — они явно мужские и женские. Однако никто на самом деле не имеет ни малейшего представления о том, как происходит эволюция самцов и самок или какие генетические изменения потребовались для ее достижения», — объясняет Умен.

Хотя геномы Chlamydomonas и Volvox во многом схожи, есть одно вопиющее исключение, которое дало исследователям Солка доступ к происхождению мужского и женского пола — так называемый локус спаривания, который функционирует во многих отношениях. так же, как человеческие X и Y хромосомы для определения пола.

Когда Умен и его коллеги исследовали гены локуса спаривания у Chlamydomonas и Volvox , они обнаружили, что они имеют некоторые общие гены, как и следовало ожидать от близкородственных видов. Тем не менее, Volvox теперь обладал удивительным разнообразием новых генов, которые были добавлены к его расширенному локусу спаривания, и экспрессия многих из этих генов попала под контроль программ дифференцировки самцов и самок.

«Мы обнаружили, что место спаривания Volvox примерно в пять раз больше, чем у Chlamydomonas », — говорит исследователь с докторской степенью и соавтор Патрик Феррис, доктор философии.Д. «Мы хотели понять эволюционную основу этого. Как это произошло? И откуда взялись эти новые гены?»

Чтобы проследить происхождение добавленных генов, команда искала возможность найти их в Chlamydomonas . «Мы обнаружили, что хотя некоторые из генов локуса спаривания в Volvox являются совершенно новыми, многие из них имеют аналоги в Chlamydomonas , которые находятся рядом с локусом спаривания», — объясняет соавтор Брэдли Олсон, доктор философии. «Итак, Volvox взял эти гены, которые изначально не имели никакого отношения к полу, включил их в свой локус спаривания и начал использовать некоторые из них в своем половом репродуктивном цикле.»

В настоящее время команда изучает эти новые гены локуса спаривания, чтобы понять их индивидуальную роль в определении пола и половом развитии.

Они уже идентифицировали ген локуса спаривания Volvox , названный MAT3, который, по-видимому, играет новую роль в половой дифференциации. MAT3 связан с человеческим геном, называемым супрессором опухоли ретинобластомы, который контролирует деление клеток и часто мутирует в раковых клетках. В Volvox MAT3, вероятно, играет роль в контроле клеточного деления, как у животных и растений, но также приобрел интригующие гендерно-специфические различия в своей последовательности и характере экспрессии, которые коррелируют с различиями в мужском/женском репродуктивном развитии.Лаборатория Умена следит за этим открытием, чтобы определить новую роль MAT3 в гендерной спецификации Volvox .

«Это исследование показывает, что Volvox и его родственники являются мощной моделью для изучения эволюции пола», — говорит Умен. «Это дает нам систему, в которой мы можем проследить историю эволюции, чтобы задать вопросы о происхождении пола и других признаков, к которым трудно подойти в таких группах, как растения и животные».

Команда также работает с коллегами над изучением места спаривания эволюционного промежуточного звена между Chlamydomonas и Volvox под названием Gonium, который имеет от четырех до 16 клеток.«Gonium позволяет нам взглянуть на этапы эволюции между Chlamydomonas и Volvox , чтобы лучше понять, как происходил эволюционный процесс», — говорит Феррис.

Помимо Ферриса, Олсона и Умена, в этой работе участвовали Питер Л. Де Хофф, доктор философии, и Са Генг, доктор философии. в Институте Солка; Стивен Дуглас, Дэвид Касеро и Маттео Пеллегрини из Калифорнийского университета в Лос-Анджелесе; Саймон Прочник из Объединенного института генома (JGI) Министерства энергетики США (DOE), Риту Рай из Института Солка и Индийского института сельскохозяйственных исследований, Нью-Дели; Джейн Гримвуд и Джереми Шмутц из Института биотехнологии Хадсона Альфа, Алабама; Итиро Нишии из Женского университета Нара, Нара, Япония; и Такаши Хамадзи и Хисайоши Нодзаки из Токийского университета, Япония.

.

0 comments on “Схема размножения хламидомонады: Изучение полового и бесполого размножения хламидомонады

Добавить комментарий

Ваш адрес email не будет опубликован.