Схема постэмбрионального развития: Урок 12. постэмбриональное развитие организма. определение пола. саморегуляция и гомеостаз. стволовые клетки — Биология — 10 класс

Этапы постэмбрионального развития человека

Основные стадии постэмбрионального развития

Постэмбриональный или, как его еще называют – постнатальный, период человеческого развития подразделяется на три основных периода:

  • ювенильный, который длиться до момента полового созревания;
  • зрелый, включающий период взрослости в половозрелом состоянии;
  • период старости, который заканчивается смертью.

Данные периоды постэмбрионального развития также можно назвать:

  • дорепродуктивный,
  • репродуктивный,
  • пострепродуктивный периоды.

При этом следует понимать условность данной схемы, т.к. реальное состояние людей одного и того же возраста может в значительной степени различаться. Для этого была введена классификация возрастов:

  • хронологический или календарный,
  • биологический.

Биологический возраст человека определяется совокупностью структурных, обменных, функциональных особенностей человеческого организма, и его приспособительными возможностями. Этот возраст может не соответствовать возрасту, указанному в паспорте.

Ювенильный период в развитии человека

Замечание 1

Ювенильный период начинается сразу после рождения. Он длится у женщин примерно до $21$ года, а у мужчин немного дольше — до $22$ лет.

Первый месяц жизни ребенка — это период новорожденности. Ребенок в это время находится в позе эмбриона, напоминающей положение плода в матке. Большая часть жизни ребенка в этот период проходит во сне.

Период с первого месяца до года называется грудным. Первый год жизни ребенка насыщен изменениями в двигательной системе. Если в конце первого месяца он только делает попытки распрямить ноги, то в полтора месяца уже может поднимать и удерживать голову, к шести месяцам сидит, а первые шаги делает в конце первого года жизни. Активно развивается в данный период психика ребенка. На втором месяце своей жизни ребенок начинает улыбаться, к четвертому месяцу исследует предметы, беря их в рот, начинает различать людей. Во втором полугодии ребенок начинает понимать некоторые фразы. Активные движения ребенка в этом периоде способствуют ускорению обменных процессов в организме растущего ребенка и нормализуют работу нервной системы. В этот период для правильного развития ребенка необходимо выполнять три правила: постепенность, повторяемость и систематичность. Четкий режим жизни позволяет выработать условные рефлексы.

Готовые работы на аналогичную тему

Раннее детство включает возраст от года до трех лет. Это период, в котором наблюдается активный рост ребенка, приобщение к пище взрослых, проявление самостоятельности и стремление к самоуважению. В раннем детстве дети овладевают новыми движениями, в игре начинают подражать взрослым.

Дошкольный период длится от трех до семи лет. Для этого периода характерен большой интерес к окружающей действительности и проявление любознательности. В этот период растет мозг и формируется внутренняя речь которая проявляется в разговорах ребенка с самим собой или с игрушками. Игра для развития ребенка в этот период имеет огромное значение.

Период от семи до семнадцати лет называется школьным и подразделяется на ранний (период от $7$ до $11$ лет), средний (период от $11$ до $15$ лет у мальчиков, от $11$ до $14$ лет у девочек) и старший (период от $15$ до $17$ лет). Для раннего школьного периода главным является овладение письменной речью, воспитание коллективизма, познание нового об окружающем мире, усвоение определенного опыта. Подростки и школьники старшего возраста характеризуются быстрыми темпами физического и полового развития. Такой ускоренный процесс называется акселерацией.

Зрелый период в развитии человека

Замечание 2

Зрелый период постэмбрионального развития наступает у мужчин примерно в $22$ года, а у женщин уже в $21$ год.

Период зрелого возраста условно можно разделить на два этапа:

  • до $35$ лет,
  • от $36$ до $60$ лет у мужчин и от $36$ до $55$ лет у женщин.

В период $30-35$ лет обнаруживаются определенные изменения физиологических реакций, изменения уровня обмена веществ. Эти симптомы предшественники инволюции. После $45$ лет у человека наблюдаются значительные изменения эндокринных функций. А после пятидесяти лет происходят изменения, означающие начало процесса старения.

Период старения человека

Замечание 3

Старение у мужчин начинается примерно после $60$ лет, а у женщин уже после $55$.

Согласно современной классификации людей в период старения можно разделить на следующие группы:

  • $60$ — $76$ лет — пожилые,
  • $75$ – $89$ лет — старые,
  • свыше $90$ лет — долгожители.

Определение 1

Старение — это закономерная стадия индивидуального развития, свойственная не только человеку, но и всем живым организмам. Старость изучает наука – геронтология, которая определяет закономерности старения и формулирует рекомендации о продлении жизни.

Существуют определенные признаки старения:

  • поседение волос, которое, надо отметить в популяции начинается после 30 лет и постоянно прогрессирует;
  • изменение текстуры кожи и ее внешнего вида кожи;
  • изменение осанки;
  • потеря мышечной силы;
  • выпадение зубов;
  • уменьшаются размеры внутренних органов;
  • кровеносные сосуды теряют свою эластичность и изменяется кровяное давление;
  • снижается иммунитет, способность к регенерации, теплообразованию;
  • ухудшается слух и снижается острота зрения;
  • сокращается время реакции, слабеет память и снижается работоспособность.

Постэмбриональное развитие насекомых

Стадия эмбрионального развития у насекомых протекает в яйце и в большинстве случаев завершается выходом наружу личинки. Постэмбриональная стадия развития стартует с момента выхода личинки и длится до окончательного превращения ее во взрослое насекомое и смерти.

Какие два типа

постэмбрионального развития существуют? В чем их различия?

1. Прямое развитие.

a)      Укажем три стадии прямого развития: яйцо — дочерний организм (похож на взрослый организм) — имаго (взрослое насекомое).

b)      Понятие «личинка» неуместно использовать при прямом развитии, так как он используется в связи с непрямым развитием.

c)      При прямом развитии молодой организм демонстрирует основные морфологические признаки половозрелой особи, хотя у него еще недоразвита половая система. Прямое развитие наблюдается, например, у птиц и млекопитающих.

d)      Прямое развитие редко встречается у насекомых, хотя можно привести в пример наиболее примитивных насекомых, относящихся к скрыточелюстным (щетинохвостка, чешуйница). Молодь морфологически практически сходна со взрослой особью, в процессе роста ее организм не претерпевает никаких значимых изменений. При прямом развитии щетинохвостки у нее лишь несколько изменяются пропорции тела и развивается половая система.

2. Непрямое развитие (также называемое развитием с превращением, метаморфозом). Только у насекомых выделяют два вида непрямого развития:

a)      Непрямое развитие с неполным превращением. В этом случае выделяются три стадии развития: яйцо — личинка — имаго (взрослое насекомое). Личинки по внешнему и внутреннему строению во многом похожи на взрослое насекомое — имеют тот же ротовой аппарат, обитают в сходных условиях, питаются сходной пищей. Однако, внимание, есть и отличия личинки от взрослого организма. Она имеет зачаточные крылья и может не иметь простых глазков (а у суданского кузнечика, например, личинки мимикрируют под муравьев, живущих по соседству). У нее так же, как и при прямом развитии, недоразвита половая система. Насекомые, как правило, неоднократно проходят линьку

на личиночной стадии, а во взрослом возрасте не линяют и уже не растут. При неполном превращении в ходе последней линьки личинка превращается в имаго. Нимфы — это личинки насекомых, развивающихся с неполным превращением. Наяды — водные личинки (нимфы) стрекоз, подёнок, веснянок.

b)      Непрямое развитие с полным превращением. Подразделяется на четыре стадии: яйцо — личинка (не похожа на взрослое насекомое) — куколка (последняя линька) — имаго. Именно здесь личинку часто называют гусеницей — она активно питается, превращается в куколку и потом во взрослое насекомое (так происходит у тутового шелкопряда).

Биологический смысл развития с полным превращением

1.      Насекомые этого типа легче выживают в природе, их личинки не конкурируют со взрослыми особями за ресурсы, так как используют другую пищу.

2.      На одной из четырех стадий развития насекомые с полным превращением способны без потерь пережить неблагоприятные условия среды (майский жук).

3.      Личинки способствуют широкому расселению вида.

Хочешь сдать экзамен на отлично? Жми сюда — подготовка к ЕГЭ по биологии онлайн

Разработка урока биологии в 9-м классе по теме «Постэмбриональный период развития»

Цели урока:

  • Закрепить знания об эмбриональном развитии организма.
  • Расширить знание учащихся о закономерностях послезародышевого развития организмов.
  • Развивать умение работать с разными источниками информации.
  • Сформировать у старшеклассников познавательный интерес к изучению проблем, связанных с послезародышевым развитием организмов.

Оборудование: электронное учебное издание (мультимедийное приложение к учебнику Н.И.Сонина, «Общая биология» 9 класс) коллекции по развитию насекомых, учебник страница 162 — 166, таблицы по развитию насекомых.

Основные понятия и термины урока: постэмбриональный период развития, яйцевые оболочки, метаморфоз.

Личностная значимость изучаемого для школьника: постэмбриональный период развития протекает у всех организмов по разному, у человека — от рождения до конца жизни.

ХОД УРОКА

1. Знакомство с задачами и планом работы на уроке

2. Проверка знаний учащихся

Фронтальный опрос класса по вопросам:

  • Перечислите типы размножения в органическом мире, дайте им
    определения
  • Какие типы деления клеток вам известны? Дайте определения.
  • В чем состоит биологическое значение митоза?
  • В чем смысл удвоения молекул ДНК?
  • Что такое оплодотворение?
  • Что такое зигота, какой набор хромосом она содержит?
  • Чем отличается функции половых клеток самок и самцов?
  • На какие периоды подразделяется онтогенез?

3. Изучение нового материала

Постановка познавательной задачи.

Выяснить: что включает в себя постэмбриональное развитие, какие виды постэмбрионального развития существуют, каков биологический смысл не прямого развития организмов, какие существуют проблемы старения?

Решение познавательной задачи.

Объяснительный рассказ с элементами беседы.

Задание классу: прослушав отрывок из мультимедийной презентации (Приложение) «Размножение и индивидуальное развитие организмов» (пункт 40 в содержании), записать определение «Постэмбриональное развитие».

Учитель: Постэмбриональное развитие организма включает в себя дорепродуктивный и пострепродуктивный периоды, после которых наступает смерть этого организма.

Записывается схема «Основные этапы постэмбрионального развития организма»

Учитель: Напоминаю, что под термином «репродукция», понимается размножение (самовоспроизведения) организмов.

Задание классу:

Опишите организм появившийся после выхода из яйца у птиц и икры у лягушки (используя рисунок 92 учебника). Выясните в чем разница.

Прослушав отрывок из мультимедийного приложения, запишите типы развития организмов в виде схемы

  • Вспомнить, что называется яйцевыми оболочками (если забыли, обратить внимание на страницу 154 учебника).
  • Используя имеющиеся знания, рассмотрев (влажные препараты) коллекции «Развитие организмов», объясните, почему оно происходит поразному? Какое значение это имеет для видов? (Если самостоятельно не дадут ответ, обратить внимание на страницу 164 учебника.)
  • Используя параграф 33 записать определение понятия «метомарфоза».
  • Выяснить биологический смысл не прямого развития организмов.

Учитель: Следует отметить, что формирование растущего организма зависит от множества факторов. Назову лишь некоторые из них: влияние отдельных клеток и тканей друг на друга, абиотические условия внешней среды в которых осуществляется процесс развития, влияние гормонов выделяемыми железами внутренней секреции, регуляция со стороны нервной системы, влияние заложенное в клетках данного организма генетической программы. Ученные выяснили, что метаморфоз лягушки регулируется гормонами щитовидной железы. Если головастика лягушки поместить в воду с такими гормонами, то у животных наблюдается преждевременный метаморфоз. При этом формируются готовые к выходу на сушу лягушата, величиной с муху.

В конце урока можно обсудить с учащимися проблему старения; выявить в беседе влияющие на него факторы, привести примеры, иллюстрирующие сроки жизни некоторых растений и животных

4. Домашнее задание:§33 подготовиться к обобщающему уроку по теме «Размножение и индивидуальное развитие организма», повторить §28-33.

5. Оценки за урок:5-8 оценок за работу на уроке.

ИНДИВИДУАЛЬНОЕ РАЗВИТИЕ. ПОСТЭМБРИОНАЛЬНЫЙ ПЕРИОД. | План-конспект урока по биологии (10 класс) на тему:

МУНИЦИПАЛЬНОЕ БЮДЖЕТНОЕ ОБЩЕОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ

МАЙОРСКАЯ СРЕДНЯЯ ОБЩЕОБРАЗОВАТЕЛЬНАЯ ШКОЛА

Конспект урока  по теме: ИНДИВИДУАЛЬНОЕ РАЗВИТИЕ. ПОСТЭМБРИОНАЛЬНЫЙ ПЕРИОД.

Биология 10 кл.16.02.12.

Дидактическая цель: создать условия для осознания и осмысления блока новой учебной информации.

Задачи:

сформировать знания о периодах постэмбрионального развития организмов ювенильном —  прямом и непрямом развитии организмов, пубертатном, старении.

развивать навыков познавательных процессов —  обобщения  полученной  информацию, вырабатывать собственное отношение к изучаемому материалу,  развитие коммуникативной компетенции.

Воспитывать личностную значимость изучения  постэмбрионального периода для сохранения  здоровья, потребность в новом знании.

ОБОРУДОВАНИЕ:  таблица «Развитие организмов», презентация, компьютер, карточки для индивидуального контроля знаний, электронное учебное издание (мультимедийное приложение Кирилла и  Мефодия) слайды — «Постэмбриональный период». 

Тип урока: урок закрепления знаний и изучения нового материала. 

Методические приёмы:  (основные виды деятельности учителя и ученика) объяснительно-репродуктивные, метод контроля,  фронтальный опрос, самостоятельная работа с учебником, беседа.

Формы деятельности учащихся:   индивидуальная, парная, работа.

Ключевые понятия: периоды постэмбрионального развития – ювенильный, пубертатный, старение. Прямое  и непрямое развитие.

ХОД УРОКА:

  1. Орг. момент.

Учитель.  Мы продолжаем изучать модуль  «Размножение и индивидуальное развитие организмов». Сегодня на уроке закрепим  знания о  размножении,   развитии организмов в природе и  изучим новый материал.

  1. Актуализация знаний.

Беседа по вопросам.

1. Вспомните формулировку биогенетического закона.  (В онтогенезе – индивидуальном развитии каждой особи  есть краткое и быстрое повторение  филогенеза,    исторического развития вида, к которому эта особь принадлежит). Ф. Мюллер, Э. Геккель, XIX в.

2. Какие типы онтогенеза выделяют у животных? (личиночный, яйцекладный и внутриутробный).

3. Чем отличается онтогенез одноклеточных от онтогенеза многоклеточных организмов?  

(у одноклеточных онтогенез начинается с возникновения организма в результате деления материнской клетки, у многоклеточных видов, размножающихся бесполым путём, онтогенез начинается с группы клеток материнского организма, у тех видов , которые размножаются половым путем, онтогенез начинается с момента   оплодотворения яйцеклетки и образования зиготы, первой клетки нового организма).

  Выполнение заданий по карточкам.

Тест по теме:

«Размножение и индивидуальное развитие организмов». 10 кл

I. Завершите предложения, вписав вместо точек необходимые термины и понятия.

1. Тип размножения, при котором формируется два вида гамет  —  гетерогаметный

2. Индивидуальное развитие организма —   ……онтогенез

3. Тип деления клеток, при котором количество хромосом уменьшается вдвое — …. мейоз

4. Клетки, образовавшиеся при первом дроблении зиготы —   …..бластомеры

5. Процесс образования мужских гамет — …. сперматогенез

6. Процесс слияния мужской и женской гамет — ….. оплодотворение.

II. Выберите правильный ответ.

1. Дочерний организм в большей степени отличается от родительских организмов при размножении:

А – вегетативном       Б – спорами          В – половом  Г – почкованием.

2. Стадии дробления, бластулы, гаструлы, образования органов характерны для индивидуального развития:

А – эмбрионального         Б – постэмбрионального

В – прямого                        Г – непрямого.

3. Однослойный шарообразный зародыш животных с полостью внутри называется:

А – гаструлой     Б – бластулой   В – нейрулой    Г – бластомером.

4. Одно удвоение хромосом и два следующих друг за другом деления характерны для процесса:

А – митоза     Б – образования спор   В – оплодотворения   Г – мейоза.

III. Дать определение:

1. Энтодерма —

2. Плацента —  

Взаимопроверка. (Ключи на экране).  (слайд 1)

I.

1. гетерогаметный

2. онтогенез  

3. мейоз

4. бластомеры

5.сперматогенез

6. оплодотворение.

II.    1 – В         2 —  А    3 – Б       4  —  Г

  1. 1. внутренний слой клеток      2.  орган, обеспечивающий потребности эмбриона

III.  Изучение нового материала.

Постановка познавательной задачи.

Выяснить: что включает в себя постэмбриональное развитие, какие виды постэмбрионального развития существуют, каков биологический смысл непрямого развития организмов, какие существуют проблемы старения?

Слайды презентации.

  1. Схема периодов постэмбрионального развития.
  2. постэмбриональное развитие.
  3. типы постэмбрионального развития.
  4. непрямое развитие.
  5. значение непрямого развития.

Старение  — запрограммированный процесс (с. 137 учебника).

Учитель.   Улучшение условий жизни, снижение уровня детской смертности, победа над многими заболеваниями – всё это приводит к возрастанию продолжительности жизни.

 Для этого необходимо, чтобы люди вели здоровый образ жизни.

Воздействие неблагоприятных факторов.

 Алкоголь, употребляемый беременной женщиной,  концентрируется в крови плода и достигает 70% от его содержания в крови матери, влияет на ЦНС,  80% новорожденных страдают дефектами умственного развития.

  Каждая сигарета, выкуренная матерью, уменьшает снабжение зародыша кислородом на 10%.

Сильное воздействие на плод оказывают наркотические вещества. Дети наркоманов считаются наркотически зависимыми. После рождения плохо развиваются и нуждаются в медицинском уходе.

  1. Рефлексия.  Итоговое тестирование.
  2. Д. з. § 37. ответить на вопросы.

I.

1. гетерогаметный

2. онтогенез  

3. мейоз

4.  бластомеры

5. сперматогенез

6.  оплодотворение.

II.    1 – В         2  —   А    3 – Б       4  —  Г

III.

1. внутренний слой клеток      

2.  орган, обеспечивающий потребности эмбриона

ОЦЕНИВАНИЕ:

5 – ОДИН НЕВЕРНЫЙ ОТВЕТ

4 – ДВА  НЕВЕРНЫХ ОТВЕТА

3 —   ТРИ, ЧЕТЫРЕ  НЕВЕРНЫХ ОТВЕТА

2 – ПЯТЬ И БОЛЕЕ НЕВЕРНЫХ ОТВЕТОВ

САМОАНАЛИЗ

урока  по теме: ИНДИВИДУАЛЬНОЕ РАЗВИТИЕ. ПОСТЭМБРИОНАЛЬНЫЙ ПЕРИОД.

Биология 10 кл.

«Постэмбриональный период развития» — реферат

Муниципальное общеобразовательное учреждение «Кисловская средняя общеобразовательная школа» Томского районаПостэмбриональное развитие организма (разработка урока по биологии 9 класса)Автор: Пшеничникова Ирина Михайловна, учитель биологии МОУ «Кисловская СОШ» Томского района Томской областип. Кисловка 2011Пояснительная записка.Урок по теме «Постэмбриональный период развития» является вторым уроком изучения Главы 13 курса «Общие закономерности» 9 класса, авторы программы и методического комплекса – Мамонтов С.Г., Захаров В.Б., Сонин Н.И. Тип урока – комбинированный (классический). При разработке сценария урока автор применил метод технологии проблемного обучения – проблемные задачи, а также варианты ИКТ. Время проведения 45 минут.Цель урока: изучение второго периода индивидуального развития организмов – постэмбрионального;развитие умений работать с текстом учебника; воспитание уважительного отношения к людям старшего возраста.Задачи урока:- сформировать знания о закономерностях постэмбрионального развития животных и растений;- охарактеризовать два типа постэмбрионального развития, раскрыв их значение для сохранения вида;- ознакомить с тремя периодами постэмбрионального развития человека.Урок начинается с непродолжительного опроса по результатам выполненного домашнего задания — ответить на вопросы №1 – 6, страница 161 учебника. Большая часть времени урока уделяется на изучение нового материала, закрепление построено чередой проблемных вопросов с последующим выполнением и обсуждением каждого из них. Презентация «Постэмбриональный период» является иллюстрацией к уроку. Более наглядного восприятия темы можно добиться, используя эту презентацию, на слайдах которой представлены и вопросы и задания для повторения, изучения и закрепления изученного на уроке материала. Использование фрагмента фильма о развитии зародыша земноводных помогает наглядно увидеть все этапы развития организма и является хорошим моментом перехода от темы «Эмбриональное развитие организма» к теме «Постэмбриональное развитие организма». На этом уроке автор не планирует оценивания работы учащихся в виде отметки.План урокаI. Проверка изученного материала по теме «Эмбриональный период развития». 8 — 10 мин. II. Изучение постэмбрионального развития организмов. 20 — 23 мин. 1. Постэмбриональный период развития как послезародышевый, начало которого связано с выходом организма из яйцевых оболочек; при внутриутробном развитии зародыша млекопитающих – с момента рождения. 2. Два вида постэмбрионального развития: прямое и непрямое. 3. Продолжительность постэмбрионального развития у разных видов. 4. Особенности роста организмов различных видов, сопровождающих постэмбриональный период. III. Закрепление по теме «Постэмбриональное развитие организмов». 8 — 10 мин. IV. Домашнее задание. 2 мин.Оборудование. Компьютер, проектор, экран, таблицы. При проверке знаний, изучении нового материала и закреплении используется презентация «Постэмбриональный период» — автор Пшеничникова И.М.; фрагмент фильма о развитии земноводных — Фильм. Биология. Часть 2. Класс Земноводные; для самостоятельной работы ученикам требуется только учебник — Биология. Общие закономерности. 9 кл. Мамонтов С.Г., Захаров В.Б., Сонин Н.И. Темп урока высокий.Ход урокаI. Проверка изученного материала по теме «Эмбриональный период развития». 8 — 10 мин.Учитель. Слайд 2. Ответьте на вопросыЧто такое зигота?Каким путем возникают новые клетки при дроблении?Чем заканчивается период дробления?Что такое бластула, бластомеры, бластоцель?Чем дробление отличается от митотического деления клеток взрослых животных?Как называется вторая стадия развития зародыша? Чем заканчивается гаструляция?Что такое зародышевые листки? Назовите их.Когда возникает третий зародышевый листок? Как он называется? (Беседа по вопросам)Учитель. Что изображено на слайде 3. (Беседа по рисункам слайда).Учитель. В повторение процессов эмбрионального периода и для перехода к следующей теме, посмотрим фрагмент фильма о развитии земноводных. (Фильм. Биология. Часть 2. Класс Земноводные. 3 мин.) На прошлом уроке мы изучили период от оплодотворения до рождения или выхода из яйцевых оболочек, сегодня следующий. Он называется – Постэмбриональный.II. Изучение этапов постэмбрионального развития организмов. Изучение начать с записи темы урока в тетрадь и последующего обзора по схеме на слайде.Учитель. В фильме мы увидели развитие лягушки, начиная с оплодотворенного яйца до появления сформированного лягушонка. Однако не все организмы проходят такой путь преобразований. В момент рождения или выхода организма из яйцевых оболочек заканчивается эмбриональный и начинается постэмбриональный период развития. Именно в этот период можно увидеть различные пути роста и развития организмов. Постэмбриональное развитие может быть прямым или сопровождаться превращением (метаморфозом). Что это означает? ( Слайд 4. Рассказ учителя по схеме). Направления постэмбрионального периода развития организма Прямое развитие(т.е. без превращении) Непрямое развитие(т.е. с превращением или с метаморфозом) Из яйцевых оболочек выходит или рождается небольшой организм, но уже с заложенными всеми основными органами (т.е. похожий на взрослую особь).Организму остается только расти и развиваться. Из яйцевых оболочек выходит организм устроенный проще и имеющий свои специальные органы – это личинка. Личинка питается, растет и со временем преобразуется во взрослый организм. При метаморфозе разрушаются личиночные органы и возникают органы, присущие взрослым животным. Учитель. Однако даже организмы, развивающиеся без превращения, начинают первый период жизни по-разному. Слайд 5.Задание 1. Подумайте, на какие две группы можно разделить только что рожденные организмы. Например, антилопа, пингвин, лошадь, человек, гусь, утка, мышь, цыпленок, воробей, крыса, крокодил, корова. Добавьте в список свои примеры. (Ответ учащихся. Организмы, требующие долгого ухода и заботы со стороны родителей. Это пингвины, воробьи, мыши, крысы, человек и др.Организмы, не требующие длительного ухода и заботы со стороны родителей. Это антилопы, зебры, лошади, коровы, гуси, утки, куры, крокодилы и др.)Учитель. Организмы, развивающиеся с превращением весьма оригинальны. Вспомним фильм и остановимся на примере развития капустной белянки и прудовой лягушки. Слайд 6.Задание 2. Воспользовавшись учебником, составьте рассказ о непрямом развитии капустной белянки и прудовой лягушки. (Задание распределить по группам или рядам) Через 3 – 5 минут, дать слово ученикам для обзора по рисункам.Учитель. Как вы думаете, одинакова ли продолжительность постэмбрионального развития у разных видов? Давайте выясним. Задание 3. Воспользовавшись § 33, страницы 162 – 166, найдите ответ на вопрос. Одинакова ли продолжительность постэмбрионального развития у разных видов? (Учащиеся находят в учебнике ответ на вопрос и записывают его в тетрадь).Учитель. У человека постэмбриональный период включает стадии: полового созревания, стадию зрелости и стадию старости. Эти периоды носят название: дорепродуктивный, репродуктивный и пострепродуктивный. Слайд 7 Периоды в постэмбриональном развитии дорепродуктивный пострепродуктивный репродуктивный (Далее учитель по схеме дает краткую характеристику каждого периода, особое внимание, уделяя особенностям пострепродуктивного периода. Именно в этот период, наши дедушки и бабушки, требуют особого внимания со стороны родных и окружающих)III. Закрепление по теме «Постэмбриональное развитие организмов». 8 — 10 мин.Учитель. И в заключение урока ответим на вопросы. Слайд 8.1. В чем заключается значение метаморфоза? 2. Можно ли считать непрямое развитие более примитивным, чем прямое?3. Какие факторы внешней среды влияют на развитие зародыша? (Учитель помогает ученикам сформулировать правильные ответы на вопросы, ответы записываются в тетрадь)IV. Домашнее задание. § 33, страницы 162 – 166, прочитать. Ответить на вопросы №1 – 4.Список литературы Мамонтов С.Г., Захаров В.Б., Сонин Н.И.Учебник. Биология. Общие закономерности. 9 кл. – М.: Дрофа, 2005. – 299 с.ил. Мамонтов С.Г., Захаров В.Б., Сонин Н.И. – УМК.

Особенности постэмбрионального биогенеза у белых крыс линии Вистар при воздействии на них оксидами азота Текст научной статьи по специальности «Животноводство и молочное дело»

БИОЛОГИЧЕСКИЕ

НАУКИ

«НАУКА. ИННОВАЦИИ. ТЕХНОЛОГИИ», №3, 2015

УДК 576.3 1.7 Иванов В.М. [Ivariov V.M]

ОСОБЕННОСТИ

ПОСТЭМБРИОНАЛЬНОГО БИОГЕНЕЗА У БЕЛЫХ КРЫС ЛИНИИ ВИСТАР ПРИ ВОЗДЕЙСТВИИ НА НИХ ОКСИДАМИ АЗОТА

The specifics of postembuonic biogenesis of vistar white mice under the effect of nitrous oxides

В данной статье приводятся данные по росту и развитию белых крыс линии Вистар, их гематологическим показателям и естественной резистентности в условиях воздействия оксидов азота. У подопытных животных уменьшаются весовые и линейные размеры, снижаются гематологические показатели и естественная резистентность по сравнению с контрольными животными, которые находятся в фоновой зоне.

Ключевые слова: постнатальный онтогенез, рост, развитие, интерьер, гематология, внутренние органы, резистентность, достоверность.

The article presents the data on the growth and development of Vistar white mice, their hematologls indices and natural resistance in the conditions of nitrous oxides effect. The weight and linear dimensions of the laboratoru animals decrease, their hematologic indices and natural reslstange also decrease in comparison with the control animals which are placed In the background zone.

Keywords: postnatal ontogenesis, growth, development, interior, hematology, internal organs, resistance, reliability.

Изучение роста и развития млекопитающих в зонах влияния различных промышленных предприятий с учётом особенностей загрязнения территорий в настоящее время актуально и имеет большое научное и практическое значение [1,139-145; 2, 983-989; 3, 428-435; 5, 485-493].

Подобные исследования выявляют негативные изменения, которые происходят в организме животных в постнатальном онтогенезе и способствуют разработке научных основ коррекции его нарушений [4, 613-621; 6, 89-95; 7, 1163-1169].

Целью наших исследований явилось изучение особенностей постэмбрионального биогенеза у белых крыс линии Вистар при воздействии на них оксидами азота. При этом решались следующие задачи: оценить рост и развитие млекопитающих; изучить гематологические показатели животных; оценить резистентность белых крыс.

Для проведения исследований, в окрестностях ОАО «Невинномыс-ский Азот» Ставропольского края, который является источником поступления в атмосферу оксидов азота (NO, N203, N05, N204), были выделены 2 зоны различные по степени загрязнения: импактная (расстояние от источника загрязнения 1-2 км) и фоновая — с расстоянием от источника загрязнения 25-30 км.

Основными источниками данных выбросов являются предприятия, производящие азотные удобрения, азотную кислоту, нитраты, анилиновые красители, нитросоединения, к которым и относится ОАО «Невинномыс-ский Азот»

В процессе исследований были сформированы две группы белых крыс линии Вистар, одна из которых:

— опытная, размещена в импактной зоне, вторая — контрольная, находилась в фоновой зоне, на расстоянии 25 км от вредного воздействия химического производства (схема 1).

Остальные условия опытов для обеих групп животных были одинаковыми, крыс содержали в стандартных условиях вивария со свободным доступом к воде и пище.

Запланированные научные исследования по выполнению поставленных задач выполнялись вначале на потомстве (крысят обоего пола), полученных от здоровых крыс, а в последующем на взрослых животных по следующим методикам. Динамика живой массы и внутренних органов, длины тела крыс определялись путем взвешивания и измерения животных в разные возрастные периоды (при рождении, 21, 150 и 250 дней). Гематологические показатели изучались по общепринятым методикам. Уровень естественной резистентности крыс в различные возрастные периоды оценивался по бактерицидной, лизоцимной активности сыворотки

крови и фагоцитарной активности крови. Показатели, полученные в результате исследований были обработаны методом вариационной статистики.

Результаты исследований

Изучение закономерностей постэмбрионального развития животных относится к одной из важных задач

Схема 1. Схема опытов

Группы животных Порода крыс Количество животных

в группе

Контрольная (1) Белые крысы линии Вистар 15

Опытная (2) Белые крысы линии Вистар 15

биологии. Онтогенез организма проходит при непрерывном взаимодействии двух процессов — роста и развития с внешней средой, протекающих одновременно. Ростом называется увеличение массы клеток организма, его тканей и органов, линейных и объёмных размеров, что осуществляется за счёт количественных изменений в результате новообразований живого вещества. Развитие есть цепь качественных изменений организма, выражающихся в изменении соотношений размеров и функций отдельных его органов и тканей.

Определение изменения живой массы и длины тела подопытных животных в условиях воздействия

промышленных предприятий и химических веществ, которые присутствуют в данной зоне, имеет большое значение при проведении биологических исследований, так как рост организма обусловлен обменными процессами данного организма в конкретных условиях окружающей

Таблица 1. Динамика живой массы подопытных крысят, М + т

Возраст, Самец, г Самка, г

дни 1 2 1 2

При рожден. 5,4±0,01 5,4±0,01 5,3±0,01 5,1±0,01

7 13,3±0,02 13,0±0,03 12,5±0,03 12,3±0,04

14 19,8±0,03 19,2±0,05 19,0±0,04 18,6±0,03

21 26,4±0,06 25,9±0,05 25,5±0,07 25,1±0,08

28 37,9+0,11 37,2±0,09 35,7±0,10 35,1 ±0,11

35 41,8±0,12 41,0±0,10 39,6±0,12 39,0±0,09

50 53,2±0,12 52,5±0,13 52,1±0,09 51,5±0,10

70 65,8±0,33 64,9±0,34 63,2±0,35 62,3±0,32

90 72,4±0,64 71,5±0,58 70,3±0,54 69,1±0,55

120 79,9±0,39 78,9±0,40 75,4±0,54 74,2±0,55

150 102,5±0,56 101,0±0,57 95,8±0,66 94,3±0,70

200 198,4±0,78 197,4±0,80 175,8±0,87 174,2±0,88

250 315,Ш,11 313,1±1,00 265,2±1,23 264,1 ±1,11

среды. Результаты данных опытов (табл. 1) показали, что в период молочного кормления, который длился 21 день был интенсивный прирост массы тела крысят обоих полов. Тем не менее, прирост живой массы у крысят — сам-

цов за данный период составил 20,5 г, у самок — 20,0 г, что меньше, чем у животных контрольных групп соответственно на 1,0 г и 0,2 г.

За период полового созревания самцы из опытной группы приросли на 75,1 г, а самки — на 69,2 г, что мень-

Таблица 2. Динамика длины тела подопытных крысят, М ± т

Возраст, Самец, мм Самка, мм

дни 1 2 1 2

При рожд. 92±0,42 91 ±0,38 91 ±0,51 90±0,44

7 140±0,56 138±0,4 134±0,48 132±0,53

14 162±0,76 158±0,85 155±0,87 151±0,55

21 170±0,87 164±0,88 162±0,99 158±0,85

28 184±0,98 178±0,99 179±1,00 174+1,11

35 197±1,12 190±1,11 189±1,04 184±1,09

50 242±1,13 236+1,10 234±1,23 228±1,22

70 248±1,45 238+1,12 240±1,56 234±1,24

90 259+1,76 24741,19 251±1,56 242±1,66

120 272±1,98 260±1,54 267±1,78 258±1,69

150 278±2,02 266±1,77 272±2,00 262±1,99

200 282±2.04 270+1,99 278±2,29 266±2,11

250 285±2,06 272±2,11 280±2,44 270±2,33

ше, чем у контрольных животных на 1,0 г и 1,1 г.

В репродуктивный период интенсивность роста опытных крысят, также была меньше, чем контрольных. Из этого следует что, отрицательное влияние ок-

Таблица 3. Возрастная динамика массы внутренних органов подопытных крысят, М + т

Группа, возраст, (дней) Масса внутренних органов, мг

тимус селезёнка печень

1, 21 16,8 ± 1,2 17,2 ± 1,9 330,2 ±30,1

2, 21 16,7 ± 1.0 19.3+1.7 337,9 ±29,8

1, 150 64,4 ±4,1 65,5 ±3,9 1336,2 ±45,8

2, 150 65,5 ± 3,9 70,1 ±5,0 1359,7 ±48,1

1, 250 85,9 ± 7,9 87,9 ±8,1 1689,8 ±69,1

2, 250 85,0 ±8,1 96,6 ±9,1 1711,9 ± 70,1

сидов азота в зоне воздействия комбината на подопытных крысят очевидно.

Крысята очень быстро росли. Детёныши были наиболее активными в возрасте 8-20 дней. С возрастом у них всё тело покрылось коротенькой шёрсткой, очень мягкой и на ощупь напоминающей велюр. Крысята активно вели себя в опытах, и с ними требовалась особая осторожность. За период молочного кормления длина тела крысят — самцов и крысят — самок опытных групп увеличилась соответственно на 73 и 68 мм, что меньше прироста длины тела у животных в контрольной группе на 0,3-0,5 мм (табл. 2). Отставание крысят опытных групп обоих полов по приросту длины тела над животными контрольных групп отмечено и по другим перио-

сердце лёгкое почки

43,2 ± 3,8 186,7 ± 7,9 30,6 ± 1,1

43,1 ± 3,3 179,2 ± 8,2 30,5 ± 1,2

160,4 ± 8,5 744,9 ± 12,8 123,8 ±7,9

159,9 ± 8,4 738,9 ± 11,9 123,7 ±8,1

195,9 ± 11,9 845,9 ± 23,6 168,5 ± 14,5

193,9 ± 12,1 845,0 ±24,1 167,4 ±13,8

дам роста: периоде полового созревания (22-150 день) на 10-12 мм, репродуктивном периоде (151-250 день) на 10-13 мм, периоде старческих изменений (старше 251 дней) более 15 мм, что свидетельствует о негативном влиянии оксидов азота и на рост подопытных животных.

Интерьер — это совокупность физиологических, биохимических, морфологических и других свойств организма в связи с его видовой принадлежностью В область изучения интерьера входят и внутренние органы млекопитающих, которые играют важную роль в обменных процессах организма, в структурно — функциональном обеспечении онтогенеза. Они являются важной составной частью кровеносной, пищеварительной, дыхательной, выделительной и других систем организма и регулируют важнейшие физиологические процессы. Поэтому очень важно знать, как повлияет воздействие оксидов азота на состояние внутренних органов крысят и их функционирование.

Особенно интенсивно масса внутренних органов подопытных крысят увеличивалась в первый период с 21 по 150 день. Например, масса печени возросла на 1021,8 мг, масса сердца и лёгкого соответственно на 116,8 и 559,7 мг. При этом необходимо отметить, что прирост таких внутренних органов как тимус, селезёнка и печень был выше у опытных животных, а прирост сердца, лёгкого и почек был больше у контрольных. Во втором и третьем периоде наиболее быстро у подопытных животных росли в своей массе такие важные органы как сердце, печень и легкое. Достоверное преимущество по росту внутренних органов (селезёнки и печени) имели подопытные крысята над своими контрольными ровесниками.

Изучение гематологических особенностей у подопытных животных в изменённых природно — климатических условиях в постнатальном онтогенезе (табл.4) объясняет многие закономерности роста и развития организма млекопитающих.

Кровь является связующим звеном между внешней средой и организмом и при этом, обладая относительно постоянными физико-химическими свойствами, отражает изменения, которые происходят в организме животных под влиянием внешней среды.

Для нас было важным узнать, как изменится состав крови крыс в постнатальном онтогенезе при воздействии на них оксидами азота.

Изучаемые нами гематологические показатели (эритроциты, лейкоциты и гемоглобин) являются индикаторами здоровья животных в определенных географических и природно-климатических условиях и отражают особенности онтогенеза данных групп млекопитающих.

Тем не менее, содержание данных показателей в крови подопытных животных обеих групп соответствовали их физиологическому статусу. Но при этом было установлено незначительное превышение по эритроцитам и гемоглобину у контрольных животных над опытными, а по содержанию лейкоцитов в крови преимущество имели крысы 2 группы.

Таким образом, картина крови у животных исследуемых групп отразила влияние на них оксидов азота и подтвердила закономерность о связи интерьера с качеством окружающей среды.

Под резистентностью понимается способность организма противостоять воздействию разнообразных по своей природе факторов. Чаще

всего для изучения естественной резистентности организма используют кровь или её составляющие — плазму, сыворотку. Интерес к гематологическим исследованиям определяется той ролью, которую играет кровь во всех физиологических функциях животного организма.

Таблица 4. Возрастная динамика гематологических показателей подопытных крысят, М ± m

Возраст, Группа Показатель, М±т

дней. Эритроциты, 1012/л Лейкоциты, 10® /л Гемоглобин, г/л

21 I 4,25±0,12 5,35±0,54 134,45±2,15

II 4,15±0,11 5,43±0,55 133,34±1,98

150 I 4,86±0,45 5,48±0,49 143,56±2,34

II 4,47±0,38 5,69±0,51 140,78±2,1

250 I 4,87±0,51 5,58±0,49 147,98±2,29

II 4,11 ±0,38 5,99±0,51 143,76±2,34

Кровь несёт в себе разнообразные иммунные тела, которые осуществляют способность организма бороться с теми или иными болезнетворными началами и с внедрившимися чужеродными веществами.

Важное клинико — диагностическое исследование крови вытекает ещё и из того, что кровь, представляя собой посредника во всех процессах обмена веществ и, находясь в постоянном контакте со всеми органами и

тканями, отражает все происходящие в них внутренние процессы, изменяясь сама как качественно, так и количественно.

Безусловно доминирующим фактором в системе естественной резистентности является фагоцитоз, выступающий в первой линии эффективных механизмов

Таблица 5. Естественная резистентность подопытных животных в возрастном аспекте, %

Возраст, дней. Группа Показатель, М±т

БАСК ЛАСК ФАК

21 I 49,1 ±1,94 24,6 ± 1,44 18,6 ±0,98

II 48,4 ±2,05 24,9 ± 1,37 18,1 ±1,00

150 I 52,8 ±2,01 27,8 ±1,18 20,4 ± 0,61

II 50,3 ±1,89 26,9 ± 1,28 19,1 ± 0,78

250 I 54,4 ±1,75 32,4 ± 1,75 22,5 ± 0,81

II 52,1 ±2,04 30,8 ± 1,65 21,8 ± 0,67

иммунологического гомеостаза животных. Фагоцитарная функция осуществляется посредством клеток — фагоцитов, в число которых входят и клеточные элементы «белой крови».

Фагоцитарная активность лейкоцитов крови подопытных животных в наших опытах (табл. 5) выражена и повышается с возрастом.

Лизоцим выполняет в организме важные биологические функции и, в первую очередь, оказывает стимулирующее воздействие на фагоцитоз, действует бактерицидно на многие микроорганизмы. Лизоцимная активность сыворотки крови животных контрольной группы на протяжении всего периода исследований была выше, чем у подопытных животных, хотя разница и недостоверна.

Интегральным отражением защитных сил организма может служить и показатель бактерицидности сыворотки крови животных. Она обеспечивается такими биологическими веществами как комплементом, опсо-нинами, лизоцимом. Необходимо отметить рост бактерицидной активности сыворотки крови с возрастом как у животных 1 группы, так и у животных 2 группы.

Таким образом, из результатов проведённых исследований можно сделать вывод, что у белых крыс в период постэмбрионального биогенеза при воздействии оксидами азота замедляется рост и развитие, снижаются гематологические показатели и естественная резистентность организма.

БИБЛИОГРАФИЧЕСКИЙ СПИСОК

1. Вётош А.Н., Лучаков Ю.И., Попов A.A., Алексеева О.С., Морозов Г.Б. Терморегуляторные реакции млекопитающих в условиях действия повышенного давления азота // Российский физиологический журнал им. И.М. Сеченова, 2003. №2. С. 139-145.

2. Галанжа Е.И., БрильГ.Е., Соловьёва A.B., Степанова Т.В. Участие оксида азота в регуляции функций лимфатических микро-

сосудов // Российский физиологический журнал им. И.М. Сеченова, 2002. №8. С. 983-989.

3. Гуцаева Д.Р., Москвин А.Н., Жиляев С.Ю., Косткин В.Б., Демченко И.Т. Роль оксида азота и углекислого газа в нейротокси-ческом действии кислорода под давлением // Российский физиологический журнал, 2004. №4. С. 428-435.

4. Новожилов A.B., Катюхин Л.Н. Динамика гематологических показателей крови белых крыс в постнатальном онтогенезе // Журнал эволюционной биохимии, 2008. Т.44. №6. С. 613-621.

5. Пшенникова МП, Попкова Е.Г., Бондаренко H.A., Малышев И.Ю., Шимкович М.В., Смирин Б.В., Манухина Е.Б. Катехолами-ны, оксид азота и устойчивость к стрессовым повреждениям: влияние адаптации к гипоксии // Российский физиологический журнал им.И.М.Сеченова, 2002. №4. С. 485-493.

6. Фадюкова O.E., Кузенков B.C., Реутов В.П., Крушинский А.Л., Буравков C.B., Кошелев В.Б. Антистрессорное и ангиопротек-торное влияние оксида азота на крыс линии Крушинского-Мо-лодкиной, генетически предрасположенных к аудиогенной эпилепсии // Российский физиологический журнал. 2005. №1. С. 89-95.

7. Федин А.Н., Постникова Т.Ю., Кузубова H.A., Данилов Л.Н., Лебедева Е.С. Динамика сокращений гладкой мышцы трахеи и бронхов крыс при ингаляции диоксидом азота // Российский физиологический журнал им. И.М. Сеченова. 2007. №10. С. 1163-1169.

Практическая работа №1 Тема: Изучение типов развития насекомых

Практическая работа №1

Тема: Изучение типов развития насекомых

Цель: научиться различать развитие насекомых с полным и неполным превращением.

Оборудование: тесты, карточки, рисунки стадий развития насекомых, схемы.

1. Рассмотрите типы постэмбрионального развития насекомых, сравните их между собой.

Развитие

Неполное превращение

Полное превращение

– личинки сходны со взрослыми особями;

– личинки совершенно не похожи на имаго;

– личинки растут, линяют, становятся все больше похожи на взрослое насекомое, переход осуществляется постепенно;

– личинки растут, линяют, но остаются не похожи на взрослое насекомое и после последней линьки превращаются в куколку;

– стадия куколки отсутствует;

– внутри куколки идет полная перестройка многих систем органов, формирование крыльев, конечностей;

– кузнечики, тараканы, клопы, стрекозы

– жуки, бабочки, осы, пчелы, муравьи, мухи

2. В соответствии с типом развития класс насекомых разделяется на отряды насекомых с неполным превращением и насекомых с полным превращением.

Насекомые

С неполным превращением

С полным превращением

Отряд прямокрылые

Отряд термиты

Отряд тараканы и богомолы

Отряд стрекозы

Отряд равнокрылые

Отряд поденки

Отряд клопы

Отряд пухоеды и вши

Отряд ручейники

Отряд бабочки

Отряд жуки

Отряд блохи

Отряд перепончатокрылые

Отряд двукрылые

3. Прочитайте текст и ответьте на вопрос текста: Какое значение в жизни насекомого имеет стадия личинки? Местообитание, пища, способ питания у личинки и взрослого насекомого отличаются. Например, гусеница бабочки, по внешнему виду похожая на кольчатого червя, питается листьями и имеет грызущий ротовой аппарат, а у бабочки сосущий ротовой аппарат и питается она нектаром. У кузнечиков, которые развиваются с неполным превращением, личинки и взрослые насекомые внешне похожи, питаются растениями и имеют грызущий ротовой аппарат. Весной у кузнечиков из яиц появляются личинки, которые после трёх линек превращаются во взрослых насекомых. Это происходит в начале июля. Таким образом, личинки и взрослые кузнечики в одно и тоже время не живут. Эти особенности развития устраняют конкуренцию между личинками и взрослыми насекомыми, что повышает выживаемость и способствует процветанию вида. На основании текста сформулируйте вывод и запишете в тетрадь.

Вывод: ________________________________________________________________________________

Задания 1: В развитии насекомых с неполным превращением отсутствует стадия:

1) куколки

2) взрослого насекомого

3) яйца

4) личинки

Задания 2: В процессе индивидуального развития бабочка капустной белянки появляется из:

 1) яйца

2) куколки

3) личинки

4) гусеницы

Задания 3: Постэмбриональное развитие с полным превращением характерно для:

1) паука-крестовика

2) майского жука

3) рыжего таракана

4) зеленого кузнечика

Задания 4: Определите последовательность стадий постэмбрионального развития жука-плавунца:

1) личинка, взрослая особь, куколка

2) куколка, личинка, взрослая особь

3) личинка, куколка, взрослая особь

4) куколка, взрослая особь, личинка

Задания 5: Стадия индивидуального развития насекомых, которая отсутствует у саранчи

1) яйцо

2) взрослый организм

3) личинка

4) куколка

Задания 6: У насекомых с полным превращением

1) личинка похожа на взрослое насекомое

2) за стадией личинки следует стадия куколки

3) во взрослое насекомое превращается личинка

4) личинка и куколка питаются одинаковой пищей

Задания 7: Установите соответствие между типом развития насекомых и характерными для него признаками: к каждой позиции, данной в первом столбце, подберите соответствующую позицию из второго столбца.

ПРИЗНАК
А) развитие происходит в четыре стадии
Б) у личинки тело разделено на три отдела
В) личинка похожа на взрослое насекомое
Г) в цикле развития присутствует стадия куколки
Д) личинка и взрослое насекомое имеют отличное внешнее строение

ТИП РАЗВИТИЯ
1) с неполным превращением
2) с полным превращением

Задания 7:

 ПРИМЕРЫ ОРГАНИЗМОВ:
А) кузнечик зелёный
Б) майский жук
В) саранча перелётная
Г) комнатная муха
Д) капустная белянка (капустница)

ТИПЫ НЕПРЯМОГО РАЗВИТИЯ:
1) с полным превращением
2) с неполным превращением

Задания 9:

Установите последовательность стадий развития божьей коровки. Запишите в таблицу соответствующую последовательность цифр.

1) взрослое насекомое
2) личинка
3) куколка
4) яйцо

Задания 10:

Для капустной белянки характерен следующий цикл развития:

 1) яйцо — -> личинка — -> куколка — -> взрослое насекомое

2) яйцо — -> куколка — -> личинка — -> взрослое насекомое

3) взрослое насекомое — -> яйцо — -> личинка

4) взрослое насекомое — -> личинка — -> куколка — -> яйцо

Ответы:

Практическая работа №1. ПРОВЕРКА.

Тема: Изучение типов развития насекомых

Вывод: личиночная стадия в развитии насекомых позволяет исключить конкуренцию между взрослыми насекомыми и их личинками, что повышает выживаемость и способствует процветанию вида.

Ответы:

1

2

3

4

5

6

7

8

9

10

1

2

2

3

4

2

21122

21211

4231

1

Эмбриональное и постэмбриональное развитие многослойного плоского червя Maritigrella crozieri; последствия для эволюции спиралевидных черт истории жизни | Frontiers in Zoology

В этом исследовании конфокальная лазерная сканирующая микроскопия в сочетании с флуоресцентным окрашиванием и иммуногистохимией позволила подробно описать расщепление поликладок, гаструляцию, мерцание, мио- и нейрогенез, а также мио- и нейроанатомию личинок. Это первое исследование, подробно изучающее развитие и топологию нервной системы личинок с использованием антител против нейротрансмиттеров, а также демонстрирующее положение нервных элементов относительно мускулатуры.Теперь можно сравнить результаты, полученные для Maritigrella crozieri , с другими поликладами и платигельминтами. Анатомия и развитие других спиралевидных личинок привлекли значительное внимание с использованием этих методов (см. [27] и ссылки в ней). Добавление эмбриологических и личиночных данных поликлада расширяет выборку таксонов в пределах Spiralia, предоставляя более полную сравнительную основу для обсуждения эволюции анатомии личинок.

Поликлады — единственные свободноживущие платигельминты, у которых эмбрионы могут выращиваться in vitro вне их непроницаемой яйцевой капсулы.Как таковые, они являются важным таксоном для изучения развития платигельминтов и изучения спирального паттерна раннего дробления. У Maritigrella crozieri дробление по типу равноквартетной спирали и выявление квадранта D происходит поздно, в начале эпиболии. По-видимому, нет разницы в размере бластомеров на двух- или четырехклеточной стадии. В поликладах макромеры намного больше, чем микромеры от первого до третьего квартета. Однако шестой цикл дробления дает значительно более крупные микромеры, чем макромеры, на стадии квартета 4.Это может быть производным признаком поликлад, хотя проверка у других архоофор Rhabditophora, таких как макростомиды, невозможна, так как паттерны дробления за пределами третьего деления скрыты желтком [28]. Однако наблюдение аналогичного паттерна было зарегистрировано у неоофорных Lecithoepitheliates [29].

Антитубулиновая иммуногистохимия на эмбрионах Maritigrella crozieri показала, что ресничный ободок является первым элементом ресничек, который появляется задолго до апикальных и каудальных ресничек.Ресничная полоса образует после гаструляции сплошную непрерывную полосу вокруг стомодеума, которая затем мигрирует в положение развивающихся личиночных долей. Ruppert [22] описывает распределение прототрохальных клеток у другой личинки Мюллера как круглую предротовую полосу, прерываемую восемью рукавообразными выростами стенки тела. Однако существуют различия в морфологии ресничных полос у 4- и 6-лопастной многослойной личинки. У Imogine mcgrathi одна ресничная полоса образует полный круг вокруг личинки на широте орального капюшона, а вторая цилиарная полоса окружает две боковые периоральные доли [21].У Pseudoceros canadensis ресничный пояс состоит из прерывистых вентральных и дорсальных петель и реснитчатых элементов на суборальной пластинке [23]. Это изменение может быть связано со стратегиями кормления. Личинки M. crozieri активно планктотрофны [26], и предполагается, что механизм планктофагии заключается в использовании цилиарного пучка для питания по течению. Сообщается, что личинки I. mcgrathi пассивно питаются микропланктоном [21]. Нет никаких доказательств того, что P.canadensis является планктотрофом, однако, учитывая имеющиеся у него дополнительные ресничные черты [23], весьма вероятно, что они участвуют в питании. Окрашивание тубулином также выделяет апикальные и каудальные реснички, реснички в развивающемся глотке, просвет кишечника и парные протонефридии. Он также использовался для визуализации развития аксонных волокон [21] (обсуждается ниже). Воротник из ресничек на стыке стомодеума и личиночной кишки присутствует у M. crozieri , как и у других поликладных личинок, исследованных Ruppert [22].

Миогенез и личиночная миоанатомия

Мускулатура взрослых Platyhelminthes состоит из мышц стенки тела, состоящих из кольцевых, продольных и диагональных миофибрилл, и паренхиматозных мышц [30]. По сравнению с другими Platyhelminthes мало данных о мускулатуре взрослых поликладов, данные только по трем видам: Planocera gilchristi [31], Notoplana acticola [32, 33] и Discocelides langi [34]. . Однако имеются онтогенетические данные о развитии мышц для трех видов: Melloplana ferruginea [20], Hoploplana inquilina [19] и Maritigrella crozieri [[20], настоящее исследование].Два последних являются непрямыми разработчиками.

Сравнение между Maritigrella crozieri и Hoploplana inquilina подчеркивает сходство в развитии мышц и топологии между шести- и восьмилопастными личинками двух разных видов в разных подотрядах (соответственно Cotylea и Acotylea). Сходства в миогенезе включают: 1) раннее формирование первичной мышечной сетки, состоящей из двух продольных мышц, передней и задней круговой мышцы. 2) Начальный период развития круговой мускулатуры с последующим ростом продольной мускулатуры.3) Сходства в положении и количестве мышц-ретракторов рта, а также в кольцах концентрических круговых мышц вокруг рта. Радиальные мышцы глотки, описанные у H. inquilina , вероятно, соответствуют паренхиматозным мышцам-расширителям рта, описанным у M. crozieri . 4) Сходная хронология и сроки развития личиночных долей, при этом ротовой капюшон и зачатки вентро-латеральных долей видны на 92% времени развития у H. inquilina и на 89% у M. crozieri .

Однако есть несколько заметных различий в развитии и топологии мышц между M. crozieri и H. inquilina . Первые первичные продольные мышцы H. inquilina располагались в латеральных положениях по сравнению с дорсальными положениями у M. crozieri . Две поперечные мышцы простираются над вершиной эмбрионов H. inquilina на 92% времени развития, и они не наблюдались у эмбрионов M. crozieri . Продольные мышцы глотки описаны в H.inquilina не наблюдались у M. crozieri . Видная диагональная мышца проходит вокруг дорсальной стороны эмбриона у H. inquilina . Этого нет у эмбрионов M. crozieri , хотя у двухдневных личинок была подсчитана одна диагональная мышца. Эта мышца становится толще в течение следующих 8 дней, за это время формируются дополнительные диагональные мышцы. Это свидетельствует о том, что у поликлад непрямого развития диагональные мышцы присоединяются к мускулатуре стенки тела в планктонный период.Наблюдаемое ускорение развития диагональных мышц у H. inquilina по сравнению с M. crozieri коррелирует с продолжительностью пребывания в планктоне. Было замечено, что личинки H. inquilina оседают через 16 дней после вылупления [11], а личинки M. crozieri оседают примерно через 3,5 недели [35].

При вылуплении прямо развивающиеся Melloplana ferruginea имеют примерно 10 пар диагональных мышц стенки тела на дорсальной стороне и 5 на вентральной стороне, много паренхиматозных дорсо-вентральных мышц и более развитую мускулатуру глотки [20] по сравнению с личинками Maritigrella crozieri . личинок M. crozieri развивают диагональные мышцы на протяжении всего пелагического периода, и предполагается, что дорсо-вентральные мышцы развиваются на более поздних личиночных стадиях, что дает пелагическим формам M. crozieri мускулатуру стенки тела, аналогичную мускулатуре стенки тела непосредственно развивающихся детенышей во время урегулирования. Таким образом, между различными способами развития наблюдается сопоставимая последовательность дифференциации мускулатуры стенки тела; с начальным установлением ортогональной сетки кольцевых и продольных мышц с последующим формированием диагональных и дорсо-вентральных мышц.Сравнение между M. crozieri, H. inquilina и M. ferruginea выявляет гетерохронию в развитии двух типов мышц, которая может коррелировать с различными стратегиями жизненного цикла. Как диагональные мышцы стенки тела, так и сложные мышцы глотки развиваются раньше у видов, которые не проводят ( Melloplana ferruginea ) или мало ( Hoploplana inquilina ) времени в толще воды по сравнению с видами, которые проводят более длительное время, питаясь планктоном ( Maritigrella crozieri). ).

Черты личиночной анатомии могут сохраняться в плане тела взрослой особи, поскольку метаморфоз состоит из серии постепенных изменений, включающих дорсо-вентральное уплощение тела и реабсорбцию личиночных долей [22, 36]. Это совсем не похоже на катастрофические движения, вызывающие метаморфоз у некоторых спиралевидных личинок (например, у немертин [37] и мшанок [38]). Данные по многослойным личинкам поздних стадий многих различных видов, собранным из планктона, показывают, что рост диагональных мышц стенки тела и дорсовентральных паренхиматозных мышц дорсо-вентрально уплощает личинку, пока она все еще активно плавает в толще воды (Rawlinson, неопубликованные данные).Весьма вероятно, что мускулатура стенки тела, которая развивается у личинки Maritigrella crozieri , сохраняется до взрослой жизни, и это, вероятно, является общей чертой развития поликладных личинок. Развитие мускулатуры, связанной с брюшной присоской, наблюдалось у поздних личинок неопознанных видов (предположительно принадлежащих к подотряду Cotylea) (дополнительный файл 1, рисунок S1d), хотя неизвестно, происходит ли это у M. crozieri . . Миогенез после заселения должен продолжаться, чтобы развить высокую плотность кольцевых, продольных и диагональных мышц стенки тела и сложные мышечные системы, связанные с мощной трубчатой ​​глоткой, щупальцами и репродуктивными структурами взрослого червя.

«Промежуточный тип» — это термин, используемый Ваннингером [27] для дифференциации способа развития кольцевых мышц у непрямо развивающихся поликладов от такового у других червеобразных спиралей. Основываясь на миогенетических описаниях Hoploplana inquilina [19] и Pseudoceros canadensis (Semmler and Wanninger, неопубликовано, цитируется в [27]), он резюмирует ранний миогенез как формирование пар вторичных кольцевых мышц между исходными двумя первичными мышцами. кольцевые мышцы-основатели, которые развиваются синхронно на противоположных концах зародыша.Деление или дублирование существующих мышечных волокон считается движущей силой роста кольцевых мышц у P. canadensis (Semmler and Wanninger, неопубликованные данные, цит. в [27]). Этот образец распределения кольцевых мышц также обнаружен у Maritigrella crozieri . Однако механизмы, которые приводят к регулярному распределению этих круговых мышц, не ясны. Ранний миогенез у M. crozieri показывает, что миофибриллы развиваются из апикального комплекса и первичных круговых мышц посредством деления (как видно на волокнах с раздвоенными концами) и удвоения (как видно на волокнах, расположенных очень близко друг к другу).Кроме того, наблюдалось ответвление кольцевых мышц от первичных продольных мышц.

Хотя деление и удвоение пионерных мышечных волокон, по-видимому, является способом миогенеза у Maritigrella crozieri , было высказано предположение, что нервные тяжи играют центральную направляющую функцию во время развития кольцевых мышц у близкородственного рабдитофорана Macrostomum hystricinum marinum [39]. У M. hystricinum marinum миграция и дифференцировка премиоцитов круговых мышц, по-видимому, пространственно ограничены нервным тяжем.Тела этих мышечных волокон располагаются рядом с основными продольными нервными тяжами, отдающими сократительную часть своих клеток в дорсальном и вентральном направлениях. У эмбрионов M. crozieri , меченных F-актином и серотонином, круговые мышцы формируются до того, как становятся видны дорсо-вентральные и дорсо-латеральные коннекторы (рис. 8B и 8C), а ранние миофибриллы пространственно не ограничены развивающимися дорсо-латеральными коннекторами. но равномерно распределены по окружности зародыша.Связь между этими типами клеток весьма вероятна, т.к. позже в развитии заметные латеральные продольные мышцы у M. crozieri действительно формируются в соответствии с уже развитыми дорсо-латеральными связками (Fig. 9C). Кроме того, существует тесная связь между типами клеток, особенно вокруг рта и глотки.

Нейрогенез и нейроанатомия личинок

Нейроанатомия личинок Polyclad была описана на ультраструктурном уровне у неизвестных видов личинок Göttes и Müllers [22] и подробно у Pseudoceros canadensis [23, 24, 40].Беглое исследование серотонинергической нервной системы было проведено у Stylostomum sanjuana [41]. Развитие личиночной нервной системы у Imogine mcgrathi было продемонстрировано на ультраструктурном уровне и с использованием антител против ацетилированного тубулина [21].

Верхушечный или лобный орган был идентифицирован ультраструктурными исследованиями у многокладчатых личинок [22–24], и была предложена железисто-сенсорная функция [22]. Согласно этим исследованиям, апикальный орган состоит из скопления моноцилиарных сенсорных клеток, окруженных кольцом шейки железистых клеток, периферически поддерживаемых микротрубочками.Шейки железистых клеток проходят через базальную мембрану, распространяясь кзади, дорсально и вентрально от нейропиля к телам секреторных клеток выше, ниже и позади мозга [22, 24]. Основания моноцилиарных сенсорных клеток располагались на вершине мозга (называемые апикальными клетками, Лакалли [24]), но прямой связи с мозгом не наблюдалось, поэтому Лакалли [24] определил, что эти апикальные клетки, вероятно, не были нервными клетками. .

Иммуногистохимические исследования [[21], это исследование] показывают иммунореактивность в виде апикальной пластинки.5HT и FMRFamide экспрессируются в кольце вокруг апикальных ресничек, и эти паттерны экспрессии могут быть локализованы в сенсорных клетках с моноресничками, описанных Lacalli [23, 24]. Если апикальный орган, описанный в Pseudoceros canadensis , находится в том же положении, что и в Maritigrella crozieri , то, по-видимому, в органе наблюдается небольшая иммунореактивность 5HT или FMRFамида. Возможно, часть ацетилированного тубулина, окрашивающегося внутри эпидермиса под апикальной пластинкой, связана с микротрубочками, которые обеспечивают периферическую поддержку шейкам клеток железы (рис.7А). Кроме того, отсутствие иммунореактивности в апикальных клетках, описанное Лакалли [24], может подтвердить его подозрения, что эти клетки, лежащие на вершине мозга (дающие многочисленные микроворсинки и одну ресничку), не являются нервными клетками, хотя это требует дальнейшего изучения. анализа, так как в нервной системе личинок обнаруживается много дополнительных нейропептидов и нейротрансмиттеров [42, 43]. Эти находки могут свидетельствовать о том, что лобный/апикальный орган ( sensu Ruppert and Lacalli) может быть более железистым, чем сенсорным, но что он окружен нервной активностью в нейропиле и апикальной пластинке.Hay-Schmidt [41] описал две серотонинергические клетки в «апикальном ганглии» личинок Stylostomum sanjuana . Эти экспрессирующие серотонин клетки эквивалентны комиссуральным клеточным телам, описанным здесь в M. crozieri , и латеральным клеточным массам, описанным в P. canadensis [23]. Они не гомологичны серотонинергическим эпидермальным клеткам, обнаруженным в апикальном органе некоторых других личинок спирали (см. ниже). Сравнительные исследования прямо развивающихся поликладных видов позволят определить, имеют ли эти виды одинаковую апикальную сенсорную пластинку или это уникальный признак пелагической стадии жизненного цикла.Реснички на апикальном и каудальном концах, с предполагаемой сенсорной функцией, были идентифицированы у непосредственно развивающихся детенышей [44].

Ацетилированные тубулинэкспрессирующие внутриэпидермальные клетки на переднем конце личинок были обнаружены у Imogine mcgrathi («клетки апикальной железы» в [21]) и Maritigrella crozieri (данное исследование). В Imogine mcgrathi 14-17 из этих клеток были обнаружены в эмбрионах более поздних стадий, аналогично в личинках Maritigrella crozieri 2-8 ацетилированных тубулин-экспрессирующих клеток образовывали билатерально симметричные кластеры в дорсальном эпидермисе на широте глаз головного мозга.Возможно, что эти клетки, экспрессирующие acTub, гомологичны внутриэпителиальным мультиреснитчатым клеткам, полностью погруженным в эпителий, описанному Lacalli в Pseudoceros canadensis [24]. Он заключает, что из-за их многоресничной организации должно быть какое-то участие в сенсорной рецепции и нервной системе. Находки в M. crozieri подтверждают эту гипотезу, поскольку наблюдались тонкие связи, ведущие от этих клеток к нейропилю (рис.5А, F). Кроме того, их сильная иммунореактивность acTub может соответствовать густому реснитчатому скоплению. Между внутриэпидермальными клетками, реагирующими на acTub, наблюдаются два различия в Imogine mcgrathi и Maritigrella crozieri . Во-первых, отростки, отходящие от этих клеток, тонкие (значительно тоньше внутриэпителиальных нервов) у М. crozieri , но толстые и набухшие у I. mcgrathi . Во-вторых, отростки от этих клеток распространяются на головной мозг на М.crozieri , тогда как у I. mcgrathi они заканчиваются на апикальной пластинке. Эти различия могут быть связаны с межвидовой изменчивостью или различиями между типами личинок (Мюллер против Гетте). Возможно, что внутриэпидермальные acTub-реактивные клетки, наблюдаемые у M. crozieri и I. mcgrathi , и внутриэпителиальные мультиреснитчатые клетки P. canadensis , являются цилиарными фоторецепторами и могут сохраняться в онтогенезе у взрослых особей. план кузова.У взрослых видов макростомид и других рабдитофоран предполагаемые световоспринимающие органы обычны и состоят из перицеребральных скоплений клеток с внутренней полостью, в которую выступают аксонемы модифицированных ресничек [45]. Реснитчатые клетки и «сенсорные чашечки» (показывающие иммунореактивность acTub), связанные с апикальными органами чувств, были описаны у личинок полихет Platynereis dumerilii [46] и брюхоногих моллюсков Nerita melanotragus [47]. Было показано, что у P. dumerilii эти клетки экспрессируют опсины [46], предполагая, что они являются цилиарными фоторецепторами и могут функционировать в ненаправленном фотоответе, таком как контроль фотопериодического поведения.Действительно, экстраокулярные фоторецепторы обнаружены у многих морских личинок [48]. Чтобы определить, являются ли эти внутриэпидермальные клетки M. crozieri цилиарными фоторецепторами, можно исследовать экспрессию опсинов и использовать эксперименты по удалению, чтобы продемонстрировать их роль, а также необходимы будущие исследования развития личинок и молодых особей более поздних стадий, чтобы определить, являются ли эти клетки сохраняются во взрослом плане тела. .Он состоит из сферического переплетения клеточных отростков, называемого апикальным сплетением (или срединным скоплением в I. mcgrathi [21]), которое расположено кпереди-дорсально от упорядоченного массива нейритов, формирующих церебральную комиссуру. Нейриты, связанные с рецепторными клетками глаз головного мозга, отличаются большим диаметром у P. canadensis , и вместо того, чтобы проникать в мозг напрямую, они проходят вниз по обеим сторонам мозга к концам комиссуры. Та же картина наблюдается и в глазничных нервах М.Крозиери . Латеральные клеточные массы, описанные у P. canadensis [23], вероятно, соответствуют комиссуральным клеточным телам M. crozieri .

Работа Лакалли [23, 24] по нейроанатомии мюллеровой личинки Pseudoceros canadensis выявила организацию центральной и периферической нервной системы. Он описал центральную нервную систему как состоящую из головного мозга, апикального органа и четырех нервных тяжей, все из которых лежат под базальной мембраной.Периферическая нервная система находится внутри эпителия и лежит полностью за пределами базальной мембраны, состоящей из нервов, связанных с цилиарным пучком. Единственный прямой контакт между центральной и периферической системами происходит на концах дорсолатеральных тяжей, где несколько нейритов пересекают базальную мембрану с соседними цилиарными нервами [23]. Сходная топология нервов выявляется у личинки Maritigrella crozieri с помощью иммуногистохимических методов, хотя фиксируются некоторые отличия.У M. crozieri различие между центральной и периферической нервной системой не столь отчетливо, поскольку нервы пересекают базальную мембрану по крайней мере в двух местах. Во-первых, в отличие от находок у P. canadensis , где дорсолатеральные коннекторы заканчиваются на ресничном тяже [24], дорсолатеральные коннекторы у M. crozieri распространяются на латеральные доли, где они становятся внешними по отношению к мускулатуры стенки тела и продолжаются в суборальной пластинке до каудального пучка, где встречаются со своей коллатеральной парой.Во-вторых, нервы, связанные с глоточной нервной системой, могут пересекать базальную мембрану, особенно нервы, экспрессирующие FMRFamide. Эти нервы соединяются с перикарионом внутриэпидермального каудального пучка через медиальный нерв и с надротовым нервным кольцом, а также соединяются субэпидермально с дорсолатеральными нервами и мозгом. Несколько других заметных различий наблюдаются в нейроанатомии личинок Pseudoceros canadensis и Maritigrella crozieri ; 1) вентро-латеральные тяжи оканчиваются по бокам ротового капюшона на Р.canadensis , тогда как у M. crozieri две вентральные коннекторы раздваиваются, при этом одна ветвь встречается с коллатеральной парой в дистальной части ротового капюшона, а вторая ветвь идет назад. 2) У P. canadensis иннервация суборальной пластинки состоит из трех нервных клеток ниже клетки отторжения (реснитчатая клетка, которая функционирует как система отторжения пищи) [41]. Однако у M. crozieri имеется значительная иннервация суборальной пластинки в виде интраэпидермальной иннервации, окружающей каудальный пучок и ведущей к кольцу глоточного нерва.

В Pseudoceros canadensis Lacalli [23] обнаружил, что большинство нервных элементов вне базальной мембраны принадлежат к отдельной внутриэпителиальной системе нервов, связанных с цилиарным пучком. Эти цилиарные нервы проходят под полосой на большей части ее длины, самые крупные из них находятся в вентролатеральных долях, где сенсорные клетки наиболее многочисленны. Большой нерв проходил над ртом, чтобы соединить цилиарные нервы вентролатеральных долей. В Maritigrella crozieri иммунореактивные клетки 5HT и FMRFamide под эпидермальными ресничками указывают на субцилиарное нервное сплетение, плотность которых увеличивается под цилиарной полосой, образуя заметную сеть по всей ее длине.С тремя использованными нервными маркерами не было идентифицировано никаких отчетливых нервных путей. По-видимому, было второе нервное сплетение под подресничным сплетением, но над мускулатурой стенки тела, которое располагалось между пучком цилиарного нерва и мускулатурой стенки тела и контактировало с ними. Различия в анатомии нервной системы, описанные между M. crozieri и P. canadensis , могут быть различиями между видами, артефактами разных типов анализа (иммуногистохимия или электронная микроскопия) или онтогенетическими различиями, при которых меньшие (150 мкм передне-задняя ось) , менее сложный (6 долей) детеныш P.canadensis немного менее развит.

Супраоральное кольцо клеток, экспрессирующих FMRFamide, было обнаружено у личинок Maritigrella crozieri (рис. 4B). Это не было описано для других личинок Müller, но Ruppert [22] наблюдал анастомоз внутриэпителиальных нейронов между двумя вентральными скоплениями нейронов непосредственно перед ртом у личинки Götte. Возможно, эта зона нервной активности связана с пищевым желобком, обнаруженным у других спиралевидных личинок, где сильно иннервированные реснички переносят частицы ко рту или контролируют секрецию слизи.

Сравнение личиночной серотонинергической нервной системы возможно у 8-лопастных личинок двух близкородственных эврилептид; Stylostomum sanjuana [41] и Maritigrella crozieri (данное исследование). Hay-Schmidt [41] описывает апикальный ганглий, содержащий пару тел серотонинергических клеток, от которых аксон отходит латерально к заднему концу, где они соединяются с кольцом серотонинергических отростков, исходящих из шести тел серотонинергических клеток (по одному на каждую латеральную долю).Отростки серотонинергических нейронов входят в цилиарную полосу, и серотонинергическая личиночная нервная система первоначально останавливается на прототрохе. Однако серотонинергическая нервная система у S. sanjuana выглядит очень похожей на таковую у M. crozieri , и при внимательном рассмотрении изображений я бы не согласился с интерпретацией Хей-Шмидта, согласно которой шесть тел серотонинергических клеток представляют по одному для каждой боковой доли. и что нервная система не простирается каудально за пределы ресничного пучка.Шесть тел серотонинергических клеток, которые он указал (его рис. 1А), выглядят эквивалентными телам дорсо-латеральной соединительной ткани M. crozieri , которые находятся в суборальной пластинке.

Из этого исследования видно, что ранний нейрогенез у M. crozieri начинается с нейротрансмиттерной (5НТ и FMRFамид) иммунореактивности в эпидермисе с образованием зачатков мозга и апикальной пластинки и их экспрессией в каудальном перикарионе. 5HT и FMRFamide, экспрессирующие дорсо-латеральные и вентро-латеральные коннекторы, мигрируют кзади.Дорзо-латеральная соединительная ткань соединяет мозговую спайку с каудальным перикарионом, а более тонкая, менее выраженная вентро-латеральная соединительная ткань раздваивается, при этом одно расширение следует за ротовым капюшоном, а второе следует за внутренним краем будущих вентро-латеральных долей. Нейрогенез был изучен только у одного другого поликлада, Imogine mcgrathi , это было проведено с использованием иммуногистохимии против acTub [21]. I. mcgrathi показывает асимметричное развитие головного мозга — нейропиле утолщается и простирается дальше с правой стороны, при этом правый мозговой глаз развивается первым.На стадии двух глаз у I. mcgrathi (их стадия 7) в мозгу формируется небольшой дорсомедиальный кластер нейронов, который направляет разветвленные отростки к апикальному пучку. Это интерпретируется как предшественник верхушечного сплетения. Окраска антителами I. mcgrathi не была достигнута после этой стадии, однако это было возможно в Maritigrella crozieri , и можно подтвердить, что этот медиальный кластер, скорее всего, является зачатком апикального сплетения («клубка») личиночный нейропиль.

Lacalli [24] считал, что взрослые и личиночные ортогоны нельзя считать эквивалентными или прямо сопоставимыми без дополнительной информации о том, как первые развиваются из поздних. Маловероятно, что взрослая нервная система развивается полностью отдельно от личиночной нервной системы из-за постепенного характера поликладного метаморфоза [22, 36]. Нейральная анатомия донной стадии Maritigrella crozieri неизвестна. Однако на примере акотилей Notoplana acticola Куповиц [49] описал взрослую нервную систему, состоящую из двух нервных сетей, которые расходятся кнаружи от переднего мозга: 1) вентральная сеть грубых нервов с сетью более тонких волокон между большими нервы, 2) дорсальная сеть тонких волокон.Предполагается, что переход M. crozieri от пелагических многолопастных личинок к уплощенным в дорсо-вентральном направлении бентосным взрослым может включать следующую перестройку топологии нервной системы: выступающие дорсо-латеральные коннективы становятся основными вентральными нервными тяжами в уплощенный взрослый; дорсальные кольцевые нервы становятся спаечными нервами, соединяющими латеральные нервы дорсально и образуя часть дорсальной сети; 5HT, экспрессирующий вентральный перикарион на нервных тяжах, которые простираются между каудальным пучком и кольцом глоточного нерва, становятся связанными с вентральной присоской.

Если действительно перестройка мышц и нервов, связанных с оседанием в бентос, происходит постепенно и незначительно, то, возможно, многослойная гаструла начинает развиваться в сторону ювенильной особи, но ранние стадии этого процесса сосуществуют с временными личиночными структурами (например, лопастями и цилиарная полоса), чтобы обеспечить временную пелагическую жизнь и способность захватывать пищу. Дальнейшее изучение поздних стадий развития личинок и расселения Maritigrella crozieri позволит оценить морфогенетические изменения, связанные с расселением.Кроме того, необходима рабочая филогения поликладов, чтобы определить полярность изменений в эволюции истории жизни внутри этой клады. Если бы косвенная история жизни была плезиоморфной, то можно было бы задаться вопросом о роли личиночных мышц и нервов в развитии ювенильного/взрослого плана тела. Если, однако, интеркаляция пелагических стадий происходила много раз независимо, то можно было бы рассмотреть, как элементы ювенильной/взрослой мускулатуры и нервной системы кооптировались или приукрашивались, чтобы выполнять механические и сенсорные функции у планктонных личинок.

Спиралевидные личиночные ресничные тяжи и апикальные органы чувств

У Platyhelminthes или Spiralia повсеместно не встречаются ни стадии спирального дробления, ни планктонные стадии жизни. Тем не менее, было высказано предположение, что личинка трохофоры представляет собой предковую питающуюся личинку Spiralia и, возможно, первичноротых [50–53]. Название трохофора использовалось в довольно широком смысле и было переопределено Роузом [54], чтобы включить личиночные формы, имеющие прототрох, происходящий из трохобластов, апикальную пластинку (и обычно апикальный пучок) и пару протонефридиев.По Роузу [54] таксонами, имеющими трохофору, являются Annelida, Echiura, Entoprocta, Mollusca и Sipuncula. Нильсен [13] добавил к этому списку немертин и платигельминтов. В соответствии с определением Роуза [54], поликладная личинка может подпадать под термин трохофора, и существует долгая история защиты филогенетической связи между поликладом и личинками трохофоры [10, 13, 22, 53, 55–58]. Тем не менее, филогения платигельминтов Элера [59] и недавние молекулярные исследования [[4-6], см. [16]] установили новую основу для интерпретации распределения личиночных форм внутри Platyhelminthes и более широкого Spiralia.Поскольку поликлады являются единственной свободноживущей линией Platyhelminth, имеющей планктонные личиночные формы, вероятность того, что планктонные личинки являются примитивной особенностью этой клады, невелика. Действительно, примитивные условия жизненного цикла поликладов остаются неясными из-за неравномерного распределения личиночных признаков внутри группы. Кроме того, сами платигельминты гнездятся внутри клады, члены которой не всегда демонстрируют планктонные личиночные стадии. Таким образом, кажется неосторожным предположить, что ресничная полоса и апикальная пластинка многослойных личинок гомологичны таковым у других спиралевидных личинок.Тем не менее аргументы в пользу гомологии личиночных признаков возникли из-за морфологического сходства личиночных признаков и из-за предположений о том, что конвергентная эволюция этих признаков маловероятна. Представленные здесь данные о развитии Martigrella crozieri позволяют провести более детальное сравнение ресничек, мио- и нейрогенеза, связанных с цилиарной полосой и апикальным органом среди личинок спирали.

Прототрох определяется как кольцо (обычно составных) ресничек на мультиреснитчатых клетках, которое происходит от трохобластов, которые демонстрируют постоянное клеточное происхождение и паттерн организации [54, 56, 60, 61].У личинок трохофор прототрох представляет собой преоральный пучок цилиарных клеток, который функционирует как основной двигательный ресничный тяж и как двигатель, генерирующий питающий ток в направлении рта. У личинок Maritigrella crozieri преоральная цилиарная полоса выполняет те же функции, и была предложена гомология многослойной цилиарной полосы с прототрохом других спиралевидных личинок на основании общего спирального расщепления [10], позиционного сходства [22] и положение клеток ресничного пояса вдоль границы первого и второго квартетных производных микромеров [[13] на основе интерпретации данных о клеточных клонах [62]].Однако Ax [1] и Jenner [63] предполагают конвергентную эволюцию на основе филогенетического распределения личиночных форм и признаков. Роуз [54] предполагает, что прототрох отсутствует у Platyhelminthes, основываясь на утверждении van den Biggelaar et al. [64, 65], поликладные личинки равномерно реснитчатые и не имеют дискретной ресничной полосы.

Данные по Maritigrella crozieri показывают ряд сходств и различий между этими цилиарными тяжами и связанными с ними мышцами и нервами.Вопреки выводам van den Biggelaar et al. [64, 65] одиночная преоральная полоса клеток с длинными ресничками имеется у M. crozieri (и у всех других поликладных личинок, исследованных автором, неопубликованные данные). Он развивается после гаструляции и ресничек эпидермиса и до развития апикальных или каудальных ресничек. Прототрох также является первым цилиарным признаком, появляющимся у личинок трохофор некоторых полихет [66, 67] и моллюсков [60]. На периоральных долях у M имеется два ряда ресничек.crozieri т.е. ротовой капюшон и обе вентро-латеральные доли. Два ряда ресничек присутствуют и в прототрохе трохофоры полихеты Pomatoceros lamarckii [66].

Отмечены различия в мускулатуре и иннервации цилиарного пучка личинок M. crozieri и прототрохов различных спиралевидных личинок. M. crozieri не имеет отчетливой мышцы прототроха непосредственно под реснитчатыми прототрохальными клетками. Мышечные кольца прототрохов такой природы встречаются у некоторых моллюсков и личинок кольчатых червей, но утрачиваются при метаморфозе [17, 66, 68].Эти мышечные кольца отсутствуют у некоторых таксонов с очень короткой личиночной фазой, таких как Scaphopod, Antalis entalis (метаморфическая компетентность достигается через 94 часа после оплодотворения) [69] и Sipuncula, , Phascolion strombus (метаморфическая компетентность 72 hpf) [70]. ]. У M. crozieri клетки цилиарной ленты образуют извитую непрерывную полосу вокруг восьми личиночных долей, многочисленные продольные и кольцевые мышцы стенки тела участвуют в движении и ориентации полосы во время сравнительно продолжительной планктонной фазы.Поскольку эти мышцы являются частью ортогональной сетки мускулатуры стенки тела, маловероятно, что они действительно являются личиночными мышцами и, вероятно, становятся частью ювенильной мускулатуры.

Серотониновая иммунореактивность в виде плотной нервной сети между реснитчатыми клетками ресничного пучка и мышцами долей M. crozieri больше напоминает обширную нервную сеть у полиплакофорана [71] и эктопрокта larvae [72], чем к отдельным меченым серотонином аксонам нервных колец прототрохов личинок некоторых полихет [66], двустворчатых моллюсков [73] и брюхоногих моллюсков [74].У ранних Platynereis dumerilii трохофор, биение цилиарной ленты и фототаксическое движение находятся под контролем фоторецепторов личинки, которые находятся в непосредственном контакте с прототрохом; два личиночных фоторецептора работают как сенсорно-моторные нейроны [43]. У личинок M. crozieri нет прямой связи светоощущения и управления цилиарной моторикой, поскольку глазные пятна не расположены рядом с цилиарным тяжем. Вместо этого нейроны из глаз централизованы через мозг, и интегрированные нейронные процессы, вероятно, координируют биение цилиарных тяжей и активность продольных, круговых и диагональных мышц для управления личинками.Сенсорные и двигательные нервы, возможно, уже дифференцировались до вылупления у M. crozieri . Будущие исследования на молекулярном уровне помогут определить, существуют ли сходные механизмы развития, участвующие в морфогенезе цилиарных тяжей у личинок разных таксонов, и раннее появление цилиарного тяжа у многослойных эмбрионов может служить эталоном для паттернов экспрессии эмбриональных генов.

Многие морские первичноротые личинки имеют апикальное скопление нейронов, расположенное под апикальной ресничкой или участком ресничек.Нейроны в этом апикальном ганглии являются одними из первых клеток, экспрессирующих нейрональный фенотип во время эмбриогенеза [75-78], и предполагается, что эти клетки индуцируют развитие церебральной системы [79, 80]. Обычно считается, что на пелагической стадии жизненного цикла этот апикальный ганглий функционирует как сенсомоторная способность преобразовывать стимулы окружающей среды в двигательные сигналы, которые модулируют мышечную и цилиарную активность личинки [74], в конечном итоге вызывая личиночное оседание и метаморфоз [81]. , 82].

Становится очевидным, что многие нейромедиаторы экспрессируются в этих апикальных нейронах [43, 83]. Однако из-за общедоступного антитела к серотонину и его сохранения у Metazoa [41] этому нейротрансмиттеру и его пространственному и временному распределению в эмбриональных и личиночных нервах на сегодняшний день уделяется наибольшее внимание. Апикальные скопления личиночных нейронов, экспрессирующих серотонин, назывались по-разному, включая «верхушечный сенсорный орган», «головной сенсорный орган», «апикальный диск», «апикальный орган» и «апикальный ганглий», и они были описаны у следующих видов. спиральные клады: Mollusca [42, 71, 74–76, 80, 84, 85], Annelida [66, 86, 87], Sipuncula [88], Phoronida [89, 90], Bryozoa [91], Brachiopoda [83], Энтопрокта [72].

Существует большое разнообразие по форме, количеству и иммунореактивности нейронов апикальных ганглиев среди спиралевидных личинок, даже внутри типов, с полным отсутствием апикальных ганглиев у Echiura [92, 93], коронатных личинок мшанок [[38], хотя см. [91]] и личинку сосудистой оболочки Cycliophora [94]. Некоторые из этих серотонинергических эпителиальных клеток имеют шейковидные апикальные выступы, придающие им форму колбы, как это наблюдается у многих таксонов моллюсков [71, 73, 74, 80, 84], энтопроктов [72]) и полихет [87]. .Однако другие полихеты [66, 86], мшанки [91] и форониды [90] не имеют такой морфологии клеток. Ваннингер [18, 27] считает плезиоморфным состоянием спиралий простой апикальный орган с примерно четырьмя серотонинергическими колбовидными клетками.

Филогенетические гомологии апикального ганглия затруднительны и должны быть основаны на сопоставимых стадиях развития. Результаты онтогенеза серотонинергической нервной системы у M. crozieri показывают, что при вылуплении простая апикальная пластинка состоит из небольшого кольца серотонин-позитивных эпидермальных клеток под цилиарным кольцом, окружающим апикальную ресничку (рис.4Е). Поэтому интраэпидермальные колбовидные серотонинергические клетки личиночного апикального органа, считающиеся плезиоморфными для спиралевидных [18, 27], не обнаруживаются на стадии вылупления M. crozieri . Однако для того, чтобы установить, что эти клетки апикального органа не обнаруживаются на разных стадиях развития, необходима пара дальнейших исследований. Во-первых, у M. crozieri эмбриональное переходное кольцо эпидермальных серотонин-экспрессирующих клеток между глазами головного мозга (рис.8D и 10C) показывает сходное с кольцом колбовидных клеток расположение личинок полиплакофорана [71] и энтопрокта [72]. Непосредственная близость этого кольца клеток к развивающимся церебральным спайкам и ассоциированным с ними телам нейронов предполагает роль в развитии мозга личинок, как было предложено для моллюсков [80]. Если это так, то можно предположить, что многослойный эквивалент колбообразных серотонинергических клеток апикального органа является эмбриональной особенностью и что церебральная система уже установлена ​​до личиночной фазы.Во-вторых, необходимо определить, развиваются ли серотонинергические колбовидные клетки у M. crozieri незадолго до поселения, поскольку считается, что эти клетки участвуют в хемосенсорном обнаружении метаморфических сигналов в велигере брюхоногого моллюска Phestilla sibogae . [95].

У ранней личинки Maritigrella crozieri экспрессирующие серотонин клетки в апикальной пластинке и их связь с нейропилем просты по сравнению со сложными апикальными органами многих других спиралевидных, которые могут включать апикальные структуры, а также латеральные ганглиозные компоненты.Является ли морфологически простая апикальная пластинка поликладов примитивным состоянием, а сложные апикальные органы многократно конвергентно развивались в отдельных линиях, еще предстоит проверить.

Несмотря на то, что это исследование выявило несколько существенных морфологических сходств и различий между цилиарными полосами и апикальным органом у разных таксонов, текущие данные не позволяют провести непроизвольное различие между параллелизмом, конвергенцией и гомологией. Более надежный филогенетический анализ позволил бы лучше различать гомологию и параллелизм, в то время как больше данных о развитии помогло бы различать конвергенцию и параллелизм [96].Принимая во внимание пятнистое распределение цилиарной ленты/прототроха и апикального органа у Spiralia, можно рассмотреть три сценария эволюции на уровне органов.

  1. 1)

    Морфологическая гомология — с ресничной полосой и апикальным органом, присутствующими на пелагической стадии последнего общего предка, с повторяющейся потерей в нескольких линиях, что объясняет неэкономное распространение на дереве.

  2. 2)

    Морфологическое сходство из-за параллелизма.Механизмы развития, образующие ресничный пояс и апикальный орган у последнего общего предка Spiralia, были рекрутированы конвергентно в таксонах с этими особенностями.

  3. 3)

    Полное сближение ресничных тяжей и апикальных органов как сходные приспособления к внешним условиям. Независимо развившиеся черты с разными механизмами развития.

Сценарий 1 принимается некоторыми [13, 27], хотя, основываясь на современной филогении спиралий и платигельминтов, распределение цилиарных полос (и, возможно, апикальных органов) не согласуется с гипотезой гомологии. Чтобы различить сценарии 2 и 3, сходство в развитии можно исследовать путем поиска общей экспрессии генов и изучения регуляции этих генов, чтобы оценить, являются ли регуляторные связи конвергентными или сходными в развитии.Это исследование предоставило анатомическую основу для проверки этих сценариев.

Постэмбриональное развитие | SpringerLink

  • Applebaum, S.W., and Heifetz, Y., 1999, Зависимая от плотности физиологическая фаза у насекомых, Annu. Преподобный Энтомол. 44 : 317–341.

    ПабМед КАС перекрестная ссылка Google ученый

  • Breuer, M., Hoste, B., и De Loof, A., 2003, Эндокринный контроль фазового перехода: некоторые новые аспекты, Physiol.Энтомол. 28 :3–10.

    КАС перекрестная ссылка Google ученый

  • Кантера, Р., Томпсон, К. С. Дж., Холлберг, Э., Нессель, Д. Р., и Бэкон, Дж. П., 1995, Миграция нейронов между ганглиями в метаморфизирующей нервной системе насекомых, Roux’s Arch. Развивать. биол. 205 :10–20.

    Google ученый

  • Картер Д. и Локк М., 1993, Почему гусеницы не становятся короткими и толстыми, Int. J. Морфолл насекомых. Эмбриол. 22 :81–102.

    Google ученый

  • Chippendale, G.M., 1977, Гормональная регуляция личиночной диапаузы, Annu. Преподобный Энтомол. 22 :121–138.

    Перекрёстная ссылка Google ученый

  • Clarke, K.U., and Langley, P.A., 1963, Исследования начала роста и линьки у Locusta migratoria migratorioides R.и Ф. IV. Связь между стоматогастральной нервной системой и нейросекрецией, J. Insect Physiol. 9 :423–430.

    Google ученый

  • Dai, J.-D., and Gilbert, L.I., 1998, Ювенильный гормон предотвращает начало запрограммированной гибели клеток в переднегрудных железах Manduca sexta , Gen. Comp. Эндокринол. 109 :155–1

    PubMed КАС перекрестная ссылка Google ученый

  • Денлингер, Д.Л., 1985, Гормональный контроль диапаузы, в: Комплексная физиология насекомых, биохимия и фармакология , Vol. 8 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Доктор Дж. С. и Фристром Дж. В., 1985, Макромолекулярные изменения в имагинальных дисках во время постэмбрионального развития, в: Комплексная физиология насекомых, биохимия и фармакология , Vol. 2 (Г.А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Farris, S.M., Robinson, G.E., Davis, R.L., and Fahrbach, S.E., 1999, Развитие личинок и куколок грибовидных тел медоносной пчелы, Apis mellifera, J. Comp. Нейрол. 414:97–11

    КАС Google ученый

  • Гилберт Л.И., Рыбчински Р. и Тобе С.С., 1996, Эндокринный каскад метаморфоза насекомых, в: Метаморфоз: постэмбриональное перепрограммирование экспрессии генов в клетках амфибий и насекомых , 3-е изд.(Л. И. Гилберт, Дж. Р. Тата и Б. Г. Аткинсон, ред.), Academic Press, Сан-Диего.

    Google ученый

  • Гупта, А. П. (редактор), 1991, Морфогенетические гормоны членистоногих: роли в гистогенезе, органогенезе и морфогенезе , издательство Rutgers University Press, New Brunswick, NJ.

    Google ученый

  • Hall, B.L., 1999, Ядерные рецепторы и гормональная регуляция Drosophila metamorphosis , Am.Зоол. 39 :714–7

    CAS Google ученый

  • Харди, Дж., и Лиз, А.Д., 1985, Эндокринный контроль полиморфизма и полифенизма, в: Комплексная физиология насекомых, биохимия и фармакология , Vol. 8 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Хеминг, Б.С., 2003, Развитие и эволюция насекомых , издательство Корнельского университета, Итака, Нью-Йорк.

    Google ученый

  • Highnam, K.C., and Hill, L., 1977, The Comparative Endocrinology of the Invertebrates , 2nd ed., Arnold, London.

    Google ученый

  • Hill, L., and Goldsworthy, GJ, 1968, Рост, пищевая активность и использование запасов личинок Locusta, J. Insect Physiol. 14 :1085–1098.

    Google ученый

  • Городиский Ф.М., 1996, Нейроэндокринный контроль шелушения насекомых с помощью гормона эклозиона, , J. Insect Physiol. 42 :917–924.

    КАС перекрестная ссылка Google ученый

  • Jones, G., and Sharp, P.A., 1997, Ultraspiracle: ядерный рецептор беспозвоночных для ювенильных гормонов, Proc. Натл. акад. науч. США 94 : 13499–13503.

    ПабМед КАС Google ученый

  • Кеннеди, Дж.С.(ред.), 1961, Полиморфизм насекомых, Symp. Р. Энтомол. соц. 1 : 115 стр.

    Google ученый

  • Кент, К.С., Консулас, К., Дункан, К., Джонстон, Р.М., Людеман, Р. и Левин, Р.Б., 1995, Ремоделирование нервно-мышечной системы насекомых во время метаморфоза насекомых, Am.Zool. 35 :578–584.

    Google ученый

  • Керкут, г.А. и Гилберт Л.И. (ред.), 1985, Комплексная физиология насекомых, биохимия и фармакология . Pergamon Press, Элмсфорд, Нью-Йорк.

    Google ученый

  • Lees, AD, 1966, Контроль полиморфизма у тлей, Adv. Физиол насекомых. 3 :207–277.

    КАС Google ученый

  • Леззи М., Бергман Т., Муйе Ж.-Ф. и Генрих В.C., 1999, Загадка рецептора экдизона, Arch. Биохимия насекомых. Физиол. 41 :99–106.

    КАС перекрестная ссылка Google ученый

  • Lüscher, M. (ed.), 1976, Определение фазы и касты у насекомых , Pergamon Press, Elmsford, NY.

    Google ученый

  • Myers, E.M., 2003, Циркадный контроль выделения, Chronobiol.Междунар. 20 :775–794.

    ПабМед КАС перекрестная ссылка Google ученый

  • Nijhout, H. F., 1994, Insect Hormones , Princeton University Press, Princeton, NJ.

    Google ученый

  • Nijhout, H.F., and Wheeler, D.E., 1982, Ювенильный гормон и физиологическая основа полиморфизма насекомых, Quart. преподобный биол. 57 :109–133.

    КАС перекрестная ссылка Google ученый

  • Oberlander, H., 1985, Имагинальные диски, в: Комплексная физиология насекомых, биохимия и фармакология , Vol. 2 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Элмсфорд, Нью-Йорк.

    Google ученый

  • Pener, M.P., 1991, Фазовый полиморфизм саранчовых и его эндокринные связи, Adv.Физиол насекомых. 23 :1–79.

    КАС Google ученый

  • Пенер М.П. и Йерушалми Ю., 1998, Физиология фазового полиморфизма саранчи: обновление, J. Insect Physiol. 44 : 365–377.

    ПабМед КАС перекрестная ссылка Google ученый

  • Ретнакаран, А., и Перси, Дж., 1985, Оплодотворение и особые способы размножения, в: Комплексная физиология насекомых, биохимия и фармакология , Vol.I (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Элмсфорд, Нью-Йорк.

    Google ученый

  • Рейнольдс С.Е., 1986, Эндокринные временные сигналы, которые управляют экдизиальной физиологией и поведением, в: Нейрохимия и нейрофизиология насекомых, 1986 (А.Б. Борковец и Д.Б. Гельман, ред.), Humana Press, Clifton, NJ.

    Google ученый

  • Риддифорд, Л.М., 1985, Действие гормонов на клеточном уровне, в: Комплексная физиология насекомых, биохимия и фармакология , Том 8 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Риддифорд Л.М., Хирума К., Лан К. и Чжоу Б.-Х., 1999, Регуляция и роль ядерных рецепторов во время личиночной линьки и метаморфоза чешуекрылых, Am.Zool. 39 :736–746.

    КАС Google ученый

  • Russell, V., and Dunn, P.E., 1996, Антибактериальные белки в средней кишке Manduca sexta во время метаморфоза, J. Insect Physiol. 42 :65–71.

    Перекрёстная ссылка Google ученый

  • Sehnal, F., 1985, Рост и жизненные циклы, в: Комплексная физиология насекомых, биохимия и фармакология , Vol.2 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Tobe, S.S., и Stay, B., 1985, Структура и регуляция corpus allatum, Adv. Физиол насекомых. 18 :305–432.

    КАС Google ученый

  • Truman, J.W., 1985, Гормональный контроль шелушения, в: Комплексная физиология насекомых, биохимия и фармакология , Vol.8 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Трумэн, Дж. В., 1990, Нейроэндокринный контроль шелушения, в: Линька и метаморфоз (E. Ohnishi and H. Ishozaki, eds.), Springer-Verlag, Berlin.

    Google ученый

  • Truman, J.W., 1992, Гормональная система насекомых, Prog. Мозг Res. 92 :361–374.

    ПабМед КАС Google ученый

  • Truman, J. W., Taghert, P. H., Copenhaver, P. F., Tublitz, N. J., and Schwartz, L. M., 1981, Эклозионный гормон может контролировать все выделения у насекомых, Nature 291 :70–71.

    КАС перекрестная ссылка ИСИ Google ученый

  • Урспрунг Х. и Нотигер Р. (ред.), 1972, Биология имагинальных дисков , Springer-Verlag, Берлин.

    Google ученый

  • Whitten, J., 1968, Метаморфические изменения у насекомых, в: Metamorphosis (W. Etkin and LI Gilbert, eds.), Appleton-Century-Crofts, New York.

    Google ученый

  • Wigglesworth, V.B., 1985, Исторические перспективы, в: Комплексная физиология насекомых, биохимия и фармакология , Vol.7 (Г. А. Керкут и Л. И. Гилберт, ред.), Pergamon Press, Elmsford, NY.

    Google ученый

  • Williams, D.W., and Shepherd, D., 2002, Постоянные личиночные сенсорные нейроны необходимы для нормального развития сенсорных афферентных проекций взрослых особей Drosophila , Development 129 :617–622

    ПабМед КАС ИСИ Google ученый

  • Инь, К.-M., и Gillott, C., 1975, Эндокринная активность во время кастовой дифференциации у Zootermopsis angusticollis Hagen (Isoptera): морфометрическое и авторадиографическое исследование, Can. Дж. Зул. 53 1690–1700.

    Google ученый

  • Житнян, Д., и Адамс, М.Е., 2000, Возбуждающая и тормозящая роль центральных ганглиев в инициации поведенческой последовательности шелушения насекомых, J. Exp. биол. 203 :1329–1340.

    ПабМед Google ученый

  • Житнян, Д., Кинган, Т.Дж., Гермесман, Дж.Л., и Адамс, М.Э., 1996, Идентификация гормона, запускающего шелушение, в эпитрахеальной эндокринной системе, Science 271 :88–91.

    ПабМед Google ученый

  • Житнян Д., Житнянова И., Спаловска И., Така Ч П., Парк Ю. и Адамс М.Е., 2003, Сохранение сигналов гормонов, запускающих шелушение, у насекомых, J.Эксп. биол. 206 :1275–1289.

    ПабМед Google ученый

  • JDB | Бесплатный полнотекстовый | Микроуправление постэмбриональным развитием дрозофилы с помощью Hox Genes

    2.1. Крылья (T2) и жужжальца (T3)
    Второй грудной сегмент (T2) дрозофилы развивает крылья, тогда как третий грудной сегмент (T3) развивает жужжальца, которые являются специализированными органами, развившимися из задних крыльев и помогающими балансировать (рис. 1). Ранее считалось, что Ubx является единственным геном Hox, ответственным за дифференцированное развитие между T2 и T3 [17].Действительно, в T3 Ubx подавляет развитие крыла, в то время как ранее считалось, что развитие крыла в T2 было «свободным от Hox» [18,19]. Однако недавно Paul et al. (2021) показали, что Antp фактически экспрессируется в крыловом мешке от первого (L1) до третьего (L3) личиночного возраста [20]. Эта ранняя экспрессия Antp ранее была упущена, а экспрессия наблюдалась только позже в шарнире и нотуме [18]. Эта более поздняя работа выявила раннюю роль Antp в определении края крыла, предполагая, что не просто подавление Ubx лежит в основе развития крыльев.Кроме того, в этом исследовании были обнаружены доказательства того, что правильная доза экспрессии гена Hox имеет решающее значение для правильного размера и формы структур, потому что слишком много или слишком мало Antp приводит к меньшим размерам крыльев [20]. Идея о том, что доза Hox может быть более важной, чем ген Hox, экспрессируемый во время развития жужжальца, ранее наблюдал Casaras et al. (1996) [21]. Например, при эктопической экспрессии Ubx, Abd-A и до некоторой степени Abd-B могут трансформировать ткань крыла в ткань жужжальца.Фактически они показали, что Abd-A может полностью, а Abd-B частично замещать Ubx в развитии жужжальца [21]. Более поздние наблюдения Paul et al. (2021) показали, что Antp и Abd-A действительно могут спасать жужжальца T3 от развития крыльев в отсутствие супрессора крыльев Ubx [20]. По-видимому, высокая доза Hox требуется для жужжальцов и более низкая для крыльев, но, что любопытно, касается ли это Antp, abd-A или Ubx в обоих зачатках, возможно, это не важно, предположительно потому, что активность Hox TF модулируется кофакторы в каждом сегменте и распознавание общего сайта связывания означают, что они могут регулировать одни и те же гены-мишени.Авторы также предполагают, что такие различия в дозировке Hox могут объяснить эволюцию различий в размере и форме между придатками крыльев T2 и T3 в более широком смысле у насекомых, а не только у дрозофилы [20]. Ubx не только подавляет крылья у T3, но и активно способствует haltere развития и морфологии путем непосредственной регуляции генов, участвующих в динамике внеклеточного матрикса [17,22,23]. Действительно, было показано, что Ubx взаимодействует со многими генами, расположенными в сети формирования паттерна крыла, чтобы подавить спецификацию специфичной для крыла морфологии, что приводит к структуре жужжальца в форме баллона и отсутствию жилок и щетинок крыла. 17,23,24,25].Кроме того, было показано, что Ubx влияет на формирование мелкомасштабного паттерна жужжальца, включая морфологию колокольчатых сенсилл [17]. Ubx также участвует в контроле размера жужжальца посредством взаимодействия с сигнальным путем Dpp [26,27]. Показано, что уменьшение дозы Ubx в жужжальцах увеличивает размер этих структур, и наоборот [28]. Недавняя работа Delker et al. (2019) дополнительно исследовала это и показала, что дифференциальная активность Ubx в зачатках жужжальца необходима для их правильной морфологии [29].Авторы продемонстрировали, что хотя Ubx создает бинарный переключатель для контроля идентичности крыла и жужжальца, уровни Ubx на самом деле различаются в компартментах жужжальца вдоль проксимо-дистальной оси. Дистальный компартмент жужжальца имеет более высокую экспрессию Ubx, чем проксимальный компартмент, что достигается отрицательной ауторегуляторной петлей через известный энхансер Ubx abx. Энхансер abx первоначально был идентифицирован как цис-регуляторный модуль, необходимый для активации Ubx в жужжальце [30,31].Однако эта более поздняя работа Делкера и его коллег (2019) показывает, что один и тот же цис-регуляторный модуль необходим как для активации, так и для репрессии, процесс, который достигается за счет небольших кластеров низкоаффинных сайтов связывания TF, которые связаны Ubx и его кофакторы, экстрадентикул (Exd) и гомоторакс (Hth) [29]. Эти сайты имеют решающее значение для достижения смещения проксимо-дистальной экспрессии в жужжальце, что имеет решающее значение для правильной морфологии. В последующем исследовании Локер и его коллеги (2021) использовали ATAC-seq и анализы связывания для дальнейшего изучения способности Ubx действовать в качестве репрессора и/или активатора в зависимости от типа клеток [32].В дистальном шарнире жужжальца (высокая экспрессия Ubx) мотив Ubx-Hth-Exd обогащен доступным хроматином, указывая на то, что в этом контексте Ubx использует свои кофакторы для активации генов [32]. Наоборот, в том же компартменте жужжальца, в клетках, где доступность хроматина ниже и нет Hth, Ubx связывается в виде мономера, репрессируя экспрессию генов [32]. Интересно, что в проксимальных клетках haltere (низкая экспрессия Ubx) также имеется обогащение мотивами Ubx-Hth-Exd в доступном хроматине, указывая на то, что в этом конкретном контексте Ubx работает с этими кофакторами для достижения репрессивной роли.Похоже, что карман жужжальца свободен от экспрессии Hth, и ни Hth, ни Exd не требуются для Ubx-зависимого развития в этой области [33,34]. Дальнейший анализ регуляторного элемента, который репрессируется с помощью Ubx в области кармана, показывает тандемный набор сайтов связывания Ubx, что может свидетельствовать о том, что мультимеризация Ubx может отрицать необходимость связывания кофактора [35]. В целом, эти данные свидетельствуют о том, что регуляция транскрипции с помощью Ubx зависит как от положения вдоль проксимо-дистальной оси, так и от доступности кофакторов [32].Это исследование также указывает на то, что Ubx может играть роль в изменении доступности хроматина специфическим для типа клеток образом, что также было показано для некоторых генов Hox млекопитающих [36,37,38].
    2.2. Leg Morphology
    Три серийно гомологичных пары ног Drosophila различаются по размеру, форме и более тонкой морфологии [39]. Эти различия частично регулируются генами Hox, действующими на разных уровнях в регуляторных сетях генов, которые определяют эти придатки и их внешний вид. Ноги T1 имеют рисунок щетинок, который отличается от ножек T2 и T3 [39,40,41,42]. .Вентрально-передняя часть дистальной части большеберцовой кости Т1 и задняя часть предплюсны имеют поперечные ряды щетинок, а не продольные ряды, как на других поверхностях ног и ногах Т2 (рис. 1) [39,43]. У самцов дистальный поперечный ряд щетинок на первом сегменте предплюсны поворачивается на 90 градусов, образуя половой гребень, состоящий из модифицированных щетинок [14,39,44] (рис. 1). Половые гребешки представляют собой быстроразвивающиеся вторичные половые структуры, которые самец использует для захвата самки во время совокупления [14,44,45].Было показано, что эти T1 и мужские особенности регулируются точной пространственной и временной экспрессией Scr [46]. Этот ген Hox экспрессируется на всем протяжении T1, но он имеет более высокую экспрессию в области, где позже формируются поперечные ряды щетинок у обоих полов [42,43]. Экспрессия Scr дополнительно повышается на стадии куколки в первом сегменте лапок самцов, что соответствует месту, где разовьется половой гребешок; однако эта экспрессия впоследствии подавляется в клетках-предшественниках щетинок [42,43,47].Экси и его коллеги (2018) идентифицировали энхансеры, которые управляют этими аспектами экспрессии Scr в ножках T1, и продемонстрировали, что удаление вышестоящего энхансера приводит к потере как поперечных рядов щетинок у обоих полов, так и половых гребней у самцов, что согласуется с требования к Scr для создания этих узоров щетинок [42,43]. Эта работа показывает, что Scr не только определяет идентификацию T1, но и интегрируется в постэмбриональную сеть регуляции генов для микроуправления морфологией ног T1.Экспрессия Scr в T1 напрямую активируется Distal-less (Dll) и репрессируется Engrailed (задним) и Bric-a-brac (дистальным), и, в свою очередь, Scr регулирует Doublesex и Delta [42,43,48,49]. Таким образом, Scr связывает сеть генов формирования паттерна ног с путем спецификации сенсорных органов как у мужчин, так и у женщин, а также регулирует путь определения пола для создания половых гребней, специфичных для мужчин (рис. 1) [42,43,48,49]. .Ubx помогает определить различия в размере и форме ножек Т2 и Т3 [50].Однако этот ген Hox также регулирует мелкомасштабную морфологию этих придатков [16,50,51]. Клетки дистальной части бедренной кости Т2 проецируют трихомы (нечувствительные актиновые выпячивания), тогда как более проксимальные клетки свободны от трихом, а кутикула гладкая, образуя так называемую «голую долину» [16,50,51, 52,53] (рис. 1). Было показано, что проксимально-дистальный градиент экспрессии Ubx в бедренной кости куколки приводит к образованию голых впадин за счет репрессии проксимальных трихом [16].Кроме того, более высокая экспрессия Ubx в бедренной кости увеличивает размер обнаженной долины, как это наблюдается у D. simulans [16] (рис. 1). Экспрессия Ubx в ножках Т2 куколки регулируется недавно открытым энхансером в 3-м интроне [54]. Любопытно, что нокдаун Dll в ножках куколки T2 расширяет голую долину и, следовательно, возможно, что Dll, по крайней мере, напрямую репрессирует Ubx, в отличие от роли Dll в активации Scr в T1 [42,54]. Хотя прямые гены-мишени Ubx в клетках бедренной кости T2 еще не идентифицированы, он действует через микроРНК-92a, которая блокирует трансляцию генов-мишеней активатора трихом Shavenbaby и лежит в основе естественной изменчивости размера голой долины [52,53,54]. ,55].Ноги Т3 имеют поперечные щетинистые ряды на задней части дистального отдела большеберцовой кости, базитарзуса и второго сегмента предплюсны [39,43]. В то время как Ubx широко экспрессируется в ножках куколки T3, он локально активируется в задних сегментах ножки куколки T3, где он направляет формирование поперечных рядов щетинок посредством репрессии Delta, например, на T3 basitarsus [43]. Эта роль Ubx сходна с ролью Scr в ножках T1 [43].
    2.3. Micromanagement of Other Aspects of Post-Embryonic Development
    Приведенные выше примеры подчеркивают глубокий анализ, который был проведен для понимания регуляции и функции Scr, Antp и Ubx в постэмбриональном формировании паттерна грудных придатков (Рис. 1).Однако ясно, что гены Hox также играют роль в управлении различными аспектами развития других сегментов во время постэмбрионального развития. управляет различными аспектами формирования взрослого эпителия, способствуя пролиферации гнездовых клеток гистобластов и активируя апоптоз личиночных эпителиальных клеток [56]. Это показывает, что abd-A связан с различными генными регуляторными сетями, которые комбинируются, чтобы специфицировать общее развитие и идентифицировать и, возможно, даже размер сегментов от A2 до A6 [56].В этой работе также подчеркивается важность дозировки Abd-A и Abd-B в определении морфологии сегмента и ставится под сомнение повсеместность правила апостериорного преобладания, поскольку эти два TF экспрессируются в одних и тех же ядрах в A5 и A6, но выполняют разные функции, предположительно посредством регуляции различных батарей генов-мишеней [56]. Abd-B также играет др. роли в формировании паттерна большинства задних сегментов брюшка, включая спецификацию задних дыхалец. В этой роли abd-B действует через динамические петли прямой и обратной связи с передачей сигналов JAK/STAT, чтобы управлять органогенезом задних дыхалец от эмбриогенеза до постэмбрионального развития [57].Эноциты личинок дрозофилы являются специализированными клетками, которые формируются кластерами под развивающимся эпидермисом и играют роль в синтезе и метаболизме липидов и углеводородов (обзор в [58]). Ранее было показано, что связывание Abd-A с ромбовидным (ро) цис-регуляторным модулем необходимо для образования личиночных эноцитов [59,60], этот процесс был дополнительно исследован Ли-Крегером и его коллегами (2012), которые обнаружили, что для образования этих специализированных клеток необходимо сложное взаимодействие между Abd-A и его кофакторами [61].В этом контексте оказывается, что Abd-A образует активирующий комплекс, состоящий из Hth, Exd и Pax2. Авторы предполагают, что Abd-A использует один и тот же сайт связывания в rho-cis-регуляторном модуле, чтобы индуцировать активацию генов клеточно-специфическим образом, взаимодействуя с Exd/Hth для ограничения связывания других ТФ, а также образуя активирующий комплекс с Pax2 [61]. Это сотрудничество между Abd-A и Pax2, как полагают, также регулирует дополнительные гены-мишени; однако необходимы дальнейшие испытания, чтобы выяснить роль, которую этот комплекс может играть во время развития [61].abd-A и Ubx также необходимы во время метаморфоза для развития сердца взрослой дрозофилы [62]. В этом контексте регуляция экспрессии этих генов Hox и модуляция активности Abd-A экдизоном необходимы для ремоделирования сердечной трубки вдоль передне-задней оси [62]. нервной системы по передне-задней оси. Тем не менее, мы начинаем в деталях понимать, как они настраивают судьбу и функции нейронов во время постэмбрионального развития для создания взрослой нервной системы, например, морфологию двигательных нейронов и нервно-мышечных сетей, как недавно было рассмотрено Джоши и его коллегами [63]. .Наконец, было показано, что Abd-B регулирует специфическую для самцов пигментацию самцов Drosophila посредством регуляции желтого цвета [15]. Было показано, что изменения в этом взаимодействии лежат в основе потери пигментации по крайней мере в одной линии, что является отличным примером того, как изменения в функции Hox во время постэмбрионального развития могут способствовать фенотипической эволюции [15].

    Новый путь сфинголипидов-TORC1 критически способствует постэмбриональному развитию Caenorhabditis elegans

    Регуляция роста и развития животных в ответ на пищевые сигналы является интенсивно изучаемой проблемой (Hietakangas and Cohen, 2009; Zoncu et al., 2011). У животных сигналы питательных веществ воспринимаются в специализированных тканях и затем передаются во все другие ткани для координации роста и развития. Комплексы-мишени рапамицина (TOR) (TORC1 и TORC2), как известно, функционируют в восприятии различных питательных сигналов (Ma and Blenis, 2009; Laplante and Sabatini, 2012; Zoncu et al., 2012), и их роль связана с ростом , метаболизм, реакции на стресс и рак (Hansen et al., 2008; He and Klionsky, 2009; Howell and Manning, 2011).В то время как аминокислоты, энергия и факторы роста были описаны как входные питательные вещества для комплексов TOR, роль молекул липидов в качестве сигналов для этих систем в контроле постэмбрионального роста и развития была неизвестна. Ясно, что также важно использовать модели целых животных для исследования того, как различные сигнальные системы в разных тканях взаимодействуют, чтобы определить решения, касающиеся постэмбрионального развития и поведения.

    В Caenorhabditis elegans первая личиночная стадия была установлена ​​в качестве модельной системы для изучения роста и развития животных в ответ на наличие пищи.При вылуплении в условиях отсутствия пищи эта нематода переходит в состояние покоя, называемое диапаузой L1 (Johnson et al., 1984; Munoz and Riddle, 2003; Baugh and Sternberg, 2006). Путь передачи сигналов рецептора инсулина/ИФР-1 (IIS) играет критическую роль в индукции диапаузы L1 и выживании животных с задержкой развития (Gems et al., 1998; Baugh and Sternberg, 2006; Kniazeva et al., 2008; Ли и Ашрафи, 2008 г.; Джонс и др., 2009 г.; Соукас и др., 2009 г.). Кроме того, было показано, что комплексы TOR играют заметную роль в регуляции постэмбрионального роста и продолжительности жизни у C.elegans (Vellai et al., 2003; Syntichaki et al., 2007; Hansen et al., 2008; Honjoh et al., 2009; Lucanic et al., 2011).

    Монометиловые жирные кислоты с разветвленной цепью (mmBCFA) широко распространены в бактериях, растениях и животных, включая человека (Nicolaides and Ray, 1965; Ran-Ressler et al., 2008). У млекопитающих mmBCFAs образуются из аминокислот с разветвленной цепью (BCAA) (Morii and Kaneda, 1982; Oku et al., 1994), хотя остальная часть пути de novo еще не определена. Физиологическая роль этих вариантов ЖК практически неизвестна, хотя было обнаружено, что они присутствуют в очень высоких количествах в некоторых тканях (Nicolaides and Ray, 1965; Ran-Ressler et al., 2008). В C. elegans из лейцина BCAA синтезируются легко определяемые mmBCFAs C15ISO и C17ISO (Князева и др., 2004). Ключевые ферменты в этом пути синтеза de novo, включая дегидрогеназный комплекс кетокислот с разветвленной цепью (BCKDC), ЖК-элонгазу (ELO-5) и ацил-КоА-синтетазу (ACS-1), эволюционно консервативны (Kniazeva et al. , 2004, 2008).

    Ранее мы показали, что только что вылупившиеся C. elegans , дефицитные по mmBCFAs, не могут инициировать постэмбриональный рост и развитие и вместо этого вступают в диапаузу L1.Дальнейший генетический анализ показал, что эта задержка развития не зависит от пути IIS (Kniazeva et al., 2004, 2008). Было неясно, была ли основная роль mmBCFAs и их производных липидов обусловлена ​​структурными требованиями для развития животных, как предполагалось в других исследованиях, или регуляторными функциями, специфическими для клеточных сигнальных процессов. Проверка этих гипотез с использованием модельных организмов имеет большое значение, поскольку роль жирных кислот и липидов в качестве сигналов питательных веществ для постэмбрионального развития в целом плохо изучена.

    В этом исследовании мы обнаружили, что (1) полученный из mmBCFA глюкозилцерамид (d17iso-GlcCer) опосредует функцию mmBCFA в стимуляции постэмбрионального роста и развития и (2) d17iso-GlcCer действует через сигнальную систему, которая включает NPRL-2 Белковый комплекс /NPRL-3 (отрицательный фактор) и TORC1 (положительный фактор) для стимуляции постэмбрионального развития.

    Постэмбриональное развитие членистоногих | Запрос PDF

    Около 90% современных видов десятиногих обитают в океанах и прилегающих прибрежных и эстуарных районах, и большинство из них проходят сложный жизненный цикл, включающий бентосную (ювенильно-имаго) и планктонную (личиночную) фазы.Личинки демонстрируют широкий спектр приспособлений к пелагической среде, включая модификации функциональной морфологии, анатомии, цикла линьки, питания, роста, химического состава, метаболизма, распределения энергии, экологии и поведения. Из-за этих адаптивных черт, которые являются основным предметом этой книги, личинки десятиногих больше похожи на неродственные голопланктонные организмы, чем на конспецифическую бентосную молодь и взрослых особей. Акцент здесь делается на менее известных анатомических, биоэнергетических и экофизиологических аспектах личиночной жизни, потому что морфология уже широко описана в литературе.Изменения биологических параметров (например, скорости питания, роста, обмена веществ) проявляются на последовательных стадиях развития, внутри отдельных стадий и в ответ на факторы внешней среды. Особое внимание уделяется взаимосвязи между внутренними явлениями (цикл линьки, органогенез, рост) и наложением эффектов внешних факторов (например, пищи, температуры, солености, загрязнения). Делая выводы из имеющихся данных, мы можем выявить основные отклонения и пробелы в наших нынешних знаниях о биологии личинок.Например, биохимические, физиологические и анатомические аспекты были исследованы гораздо меньше, чем морфология, экология и поведение личинок, а биоэнергетические параметры в основном изучались как изолированные физиологические признаки, а не пытались количественно оценить общее распределение химической энергии. Мало что известно также о внутривидовой изменчивости внутри отдельных популяций или между ними. Это остается серьезной проблемой для личиночного биолога, поскольку знание фенотипической пластичности и генетической дивергенции, например.грамм. в морфологии личинок или устойчивости к стрессу имеет первостепенное значение для понимания эволюционной адаптации и видообразования. В частности, ранние онтогенетические приспособления к экстремальным или непредсказуемым экологическим условиям важны при эволюционных переходах от морских к лимническим или наземным средам. Нам также необходимо больше сравнений между полевыми и лабораторными наблюдениями, чтобы «откалибровать» полевые данные с данными, полученными в контролируемых условиях; и наоборот, эти сравнения должны помочь выявить «эффекты одомашнивания» и другие артефакты, потенциально имеющие отношение к лабораторным данным.Кроме того, будущие исследования должны все чаще учитывать эффекты, которые сохраняются на протяжении последовательных жизненных фаз, т.е. факторы эмбриональной акклиматизации на устойчивость личинок к стрессу или значение состояния личинок для последующего заселения и успешного пополнения.

    Постэмбриональное развитие иммунологического барьера в селезенке кур

    Иммунная система птиц улучшается с развитием лимфоидных органов. Селезенка цыплят служит самым большим периферическим лимфоидным органом, но иммунологических исследований этой селезенки в постэмбриональном развитии было проведено мало.Мы исследовали гемато-селезеночный барьер (ГСБ) путем разработки морфологической архитектуры, устойчивости к корпускулярному антигену, распределения иммуноцитов, уровней экспрессии генов TLR2/4 и цитокинов в селезенке вылупившихся цыплят разного возраста. Результаты показали, что устойчивость BSB к экзогенным углеродным частицам улучшалась по мере морфологического и структурного развития селезенки цыплят. Кубические эндотелиальные клетки, которые выстилают покрытые оболочкой капилляры, постепенно становятся видимыми, а прерывистая базальная мембрана утолщается во время постэмбрионального развития.Между вылуплением и взрослением в селезенке цыплят наблюдалось увеличение количества Т- и В-клеток и антигенпрезентирующих клеток. Уровни экспрессии мРНК TLR2/4, IL-2, IFN- γ и TNF- α были выше через две недели после вылупления, но они снижались и оставались стабильными между 21 и 60 днями. С возрастом BSB развивался структурно и функционально. Наши результаты обеспечивают лучшее понимание иммунной функции селезенки и патогенеза иммунологии птиц при инфекционных заболеваниях.

    1. Введение

    Селезенка является крупнейшим периферическим лимфоидным органом у кур и играет важную роль как в антибактериальном, так и в противовирусном иммунном ответе против приобретенных антигенов. Лимфоциты, которые мигрируют в периферические лимфоидные органы птиц, происходят из центральных иммунных органов, которые пролиферируют и дифференцируются во время эмбрионального развития. Развитие периферических лимфоидных органов тесно связано с поддержанием иммунной функции [1]. Во время эмбрионального развития селезенка функционирует как орган кроветворения.После миграции лимфоцитов и образования красной и белой пульпы селезенка играет ключевую роль в иммунных реакциях, особенно на антигены крови [2]. Эмбрионам млекопитающих предоставляется доступ к врожденной иммунной системе материнских антител через плаценту, в то время как у яйцекладущих птиц иммунный механизм отличается. Сообщалось, что материнские иммуноглобулины курицы сначала выделяются в желтке созревающих ооцитов, а затем транспортируются через желточный мешок в кровоток развивающейся курицы [3, 4].

    Поскольку в иммунной системе курицы отсутствуют лимфатические узлы, но есть фабрициевая сумка, она занимает ключевое место в филогенезе. Существуют существенные структурные и функциональные различия между иммунной системой птиц и млекопитающих. Эти различия включают главный комплекс гистосовместимости (MHC) и соматическую рекомбинацию в формировании разнообразия антител [5, 6]. Растет число исследований, изучающих иммунологические ответы в селезенке кур [7, 8].Вследствие слаборазвитости лимфатических сосудов у птиц паренхима селезенки кур разделена на два дифференцированных компартмента — красную и белую пульпу — без признаков маргинальной зоны. Гематоселезеночный барьер (ГСБ) охарактеризован как фильтрующее ложе и располагается в краевой зоне селезенки грызунов [9, 10]. Предыдущие исследования идентифицировали BSB у цыплят, описывая ретикулярный каркас, представленный в эллипсоиде селезенки, и PELS, который защищает селезенку от инвазии циркулирующих патогенов [11].Имеются ограниченные сведения о морфологических особенностях и иммунологических механизмах БСБ у млекопитающих, а также о структуре и функции БСБ у кур в постэмбриональном развитии.

    Врожденная иммунная система вносит решающий вклад в воспаление, вызванное микробной инфекцией или повреждением тканей. Толл-подобные рецепторы (TLR) являются важными рецепторами распознавания образов (PRR) в системе врожденного иммунитета, которые экспрессируются как на иммуноцитах, так и на неиммунных клетках, что означает, что они являются первым барьером, образованным врожденной иммунологической защитой [12, 13].TLR действуют как стражи врожденной иммунной системы. Распознавание патоген-ассоциированных молекулярных паттернов (PAMP) с помощью TLR приводит к воспалительному иммунному ответу, характеризующемуся продукцией активного кислорода, промежуточных соединений азота и провоспалительных цитокинов. Куриные TLR состоят из 10 генов, которые напоминают человеческие, и на два меньше, чем у мышей [14]. Различные TLR играют решающую роль в активации иммунного ответа. Хиггс и др. сообщили об уровне транскрипции TLR как во время эмбрионального развития, так и после инфекции Salmonella enterica serovar typhimurium, которая обнаружила, что инфекция Salmonella enterica приводит к значительной индукции TLR4.TLR2 и TLR4 опосредуют окислительный взрыв в гетерофилах цыплят, когда их стимулируют липотейхоевой кислотой и ЛПС [15]. Однако остается неясным, связана ли экспрессия TLR2/4 в селезенке цыплят после вылупления с развитием БСБ системы врожденного иммунитета или же существует различие в экспрессии TLR2/4 в разные возрасты развития цыплят. куриная селезенка. Продукция цитокинов, участвующих в ранней стадии иммунного ответа, опосредует эффекты врожденного и адаптивного иммунитета.Цитокины продуцируются разными типами клеток и способны оказывать регуляторное влияние как на гемопоэтические клетки, так и на иммуноциты, участвующие в защите хозяина и гомеостазе [16]. Однако цитокины, используемые в развитии иммуноцитов, недостаточно хорошо описаны в иммунологическом барьере куриной селезенки. Чтобы лучше понять иммунную функцию во время постэмбрионального развития селезенки цыплят, мы исследовали иммунный барьер и развитие морфологической архитектуры, устойчивость к экзогенным углеродным частицам, распределение иммуноцитов и экспрессию иммунологических генов в селезенке цыплят различных типов. возраста после вылупления.Лучшее понимание иммунной функции BSB во время постэмбрионального развития куриной селезенки может улучшить наше понимание иммунологии птиц и патогенеза инфекционных заболеваний у кур.

    2. Материалы и методы
    2.1. Животные

    Все эксперименты проводились в соответствии с рекомендациями Комитета научно-исследовательского института животных Нанкинского сельскохозяйственного университета, Китай. Яйца бройлеров SPF Sanhuang инкубировали при температуре 38,3°C и относительной влажности 70% в течение двух-трех дней.Выведенные цыплята содержались в специфической безпатогенной среде и не были вакцинированы против каких-либо болезней. В исследовании использовали цыплят-бройлеров породы саньхуан в возрасте 1, 7, 14, 21, 35 и 60 дней. Все животные были подвергнуты эвтаназии путем смещения шейных позвонков после внутривенного введения 3% пентобарбитала натрия (25 мг/кг). Процедуры забоя и отбора проб были одобрены комитетом по этике экспериментальных животных Нанкинского сельскохозяйственного ветеринарного колледжа; идентификатор утверждения: SYXK (SU) 2010-0005.

    2.2. Ink Injection

    Цыплятам разного возраста вводили тушь (5 мл/кг, Aolindan), содержащую 50-100 нм углеродных частиц. Тушь, разбавленную 1 : 10 PBS, вводили внутривенно после анестезии 3% пентобарбиталом натрия (25 мг/кг, Sigma-Aldrich). Цыплятам контрольной группы внутривенно вводили тот же объем PBS. В каждой группе было по пять цыплят. Селезенки собирали через 30 минут после инъекции и парафиновые срезы, фиксированные формалином (5  мкм м), оценивали с помощью световой микроскопии с окрашиванием HE или без него.

    2.3. Трансмиссионная электронная микроскопия

    Образцы селезенки были получены сразу после вскрытия. Образцы разрезали на небольшие блоки (1 мм 3 ), погружали в 2,5% фиксатор глутарового альдегида в 0,01М фосфатно-солевом буфере (PBS; pH 7,4) при 4°C в течение ночи. Затем их погружали в 1% четырехокись осмия в том же буфере на 60 мин. Образцы обезвоживали в восходящей концентрации этилового спирта, предварительно пропитывая смесью пропиленоксид-аралдит и заливая в аралдит.Ультратонкие срезы окрашивали уранилацетатом и цитратом свинца в течение 20 мин каждый. Срезы исследовали и фотографировали с помощью просвечивающего электронного микроскопа Н-7650 (Hitachi).

    2.4. Иммуногистохимия

    Образцы селезенки фиксировали в 4% забуференном параформальдегиде в течение более 24 часов и заливали в парафин. Парафиновые срезы (5  мкм м) вырезали и окрашивали иммуногистохимическими методами [17]. Срезы инактивировали 3% перекисью водорода в течение 10 мин, а затем блокировали 5% раствором бычьего сывороточного альбумина.Первичные анти-куриные антитела CD3 (CT-3, 8200-01, Southern Biotech), Bu-1 (AV20, 8395-01, Southern Biotech) и MHC II (21-1A6, ab34031, Abcam) инкубировали при 4 °С в течение ночи в разведении 1:150. В качестве вторичного антитела использовали биотинилированный козий антимышиный IgG (Boster Biotechnology). Для разработки использовали комплекс авидин-биотинилированная пероксидаза и DAB (Boster Biotechnology). Вместо первичных антител использовали отрицательный контроль с PBS. Изображения были получены с использованием микроскопа Olympus (BX53).

    Измерения количества клеток проводились с использованием Image-Pro Plus 6.0 (Media Cybernetics, Silver Spring, MD). Положительные площади выражали как интегральную оптическую плотность (ИОП). Средние результаты шести полей зрения на секцию использовались для расчета IOD.

    2.5. Выделение РНК и анализ методом количественной ПЦР

    Тотальную РНК экстрагировали из куриных селезенок с использованием реагента TRIzol (Invitrogen, Карлсбад, Калифорния, США) в соответствии с инструкциями производителя. Затем выделенную РНК обратно транскрибировали в кДНК с использованием системы синтеза первой нити SuperScript (Invitrogen, Карлсбад, Калифорния, США).Количественную ПЦР в реальном времени (кПЦР) проводили с помощью системы ПЦР в реальном времени MyiQ2 (Bio-Rad, Калифорния, США). Была проведена система ПЦР, содержащая SYBR Green Supermix (Invitrogen, Карлсбад, Калифорния, США), 10 мМ специфического праймера и 0,1 мкг матричной кДНК. Реакции проводили со стадией денатурации 95°С в течение 10 с, затем 35 циклов: 95°С в течение 5 с, 60°С в течение 30 с и 72°С в течение 10 с. Относительную экспрессию генов-мишеней относили к β -актину и затем анализировали методом 2 -ΔΔCT [18].Каждый эксперимент проводили в трех повторностях. По последовательностям генов в базе данных NCBI с помощью программы Beacon Designer 7.0 (Premier Biosoft International, США) были сконструированы специфические праймеры. Пармирские последовательности, используемые в этом исследовании, можно увидеть в таблице 1.

    NM205518


    целевые гены GenBank Accession Primer Sequence (5-3)

    TLR2 XM015301380 F: ATCCTGCTGGAGCCCATTCAGAG
    Р: TTGCTCTTCATCAGGAGGCCACTC
    TLR4 NM001030693 F: AGTCTGAAATTGCTGAGCTCAAAT
    Р: GCGACGTTAAGCCATGGAAG
    Ил-2 XM015276098 F: CAAGAGTCTTACGGGTCTAAATCAC
    R:GTTGGTCAGTTCATGGAGAAAATC
    IFN- γ NM205149.1 F: GACAAGTCAAAGCCGCACA
    Р: TCAAGTCGTTCATCGGGAGC
    ФНО- α XM015294125 F: GGACAGCCTATGCCAACAAG
    Р: ACACGACAGCCAAGTCAACG
    β-актина F:GAGAAATTGTGCGTGACATCA
    R:CCTGAACCTCTCATTGCCA

    2,6894. Статистический анализ

    Все данные были выражены в виде .Статистический анализ проводили с использованием программного обеспечения SPSS версии 14.0. Использовался однофакторный дисперсионный анализ с последующим тестом Дункана. значения <0,05 считались достоверными различиями.

    3. Результаты
    3.1. Расположение гемато-селезеночного барьера после развития эмбриона

    Для изучения развития гемато-селезеночного барьера у вылупившихся цыплят птицам разного возраста внутривенно вводили тушь (рис. 1). Через 30 минут после инъекции чернил поглощение углеродных частиц было частично ограничено эллипсоидом, при этом большая часть углеродных частиц диспергировалась в красной пульпе через день после вылупления.До 14 дней в красной пульпе также были частицы углерода. Однако частицы углерода в красной пульпе постепенно уменьшались через 14 дней. Практически отсутствовал углерод в красной пульпе, лимфатическом узле и БАЛС в селезенке цыплят 35- и 60-дневного возраста. Это свидетельствует о том, что способность углеродных частиц белой пульпы ограничивать эллипсоиды увеличилась.

    3.2. Морфологическая характеристика селезенки цыплят в период постнатального развития

    Через сутки после вылупления селезенка цыплят состояла из белой и красной пульпы (рис. 2).PELS развился раньше, чем PALS, и вокруг эллипсоида и PELS было ограниченное количество лимфоцитов. Через день после вылупления почти не было обнаружено лимфатических узлов или PALS. Вместо этого через 7 дней образовались лимфатические узлы и БАС. Площадь PALS и лимфатического узла увеличилась, а структура лимфатического узла стала отчетливо видна на 14-й день. Через 21 день как PELS, так и PALS увеличились, а структура селезенки цыплят имела тенденцию к стабилизации. К 60-му дню структура селезенки кур полностью сформировалась.Диаметр пулей и PALS, как правило, увеличивается и развивается, как показано в таблице 2.


    8 D C


    Возраст средний диаметр петлей ( μ м) средний диаметр ( μ M)

    1 D D
    7 D C C
    14 D б с
    21 г б б
    35 г б
    60 г a a

    Данные без одинаковых надстрочных индексов (a–d) отличаются знаком значительно ().
    3.3. Ультраструктурный эндотелий капилляров оболочки селезенки в селезенках кур разного возраста

    Электронно-микроскопическое исследование показало, что эндотелиальные клетки покрытых оболочкой капилляров были редкими; межклеточное пространство было сравнительно большим; просвет эндотелиальных клеток был небольшим; и базальная мембрана не могла быть ясно видна. На 7-е сутки количество эндотелиальных клеток вокруг капилляров увеличилось; межклеточное пространство стало меньше и компактнее; эндотелиальные клетки имели четко выраженную кубическую форму; и базальная мембрана была тоньше, чем у 60-дневных цыплят.Через 35 и 60 дней кубовидные эндотелиальные клетки были четко видны, а прерывистая базальная мембрана утолщалась с возрастом (рис. 3).

    3.4. Распределение лимфоцитов и антиген-презентирующих клеток в гемато-селезеночном барьере кур

    CD3 и Bu-1 являются маркерами Т- и В-клеток соответственно. Результаты иммуногистохимии показали распределение Т- и В-клеток в селезенке цыплят разного возраста (рис. 4). CD3 + Т-клетки куриной селезенки были в основном распределены вокруг центральной артерии и красной пульпы.С возрастом постепенно увеличивалось распределение Т-клеток CD3 + в красной пульпе и вокруг центральной артерии. Bu-1 + В-клетки были в основном локализованы в эллипсовидных и лимфатических узлах, хотя некоторые из них были локализованы в красной пульпе. В-клетки Bu-1 + отображались в форме кольца вокруг капилляра через день после рождения, тогда как площадь положительных В-клеток вокруг эллипсоида увеличивалась с 1 до 60 дней после вылупления. MHC II представляет собой класс молекул главного комплекса гистосовместимости, который экспрессируется на антигенпрезентирующих клетках, включая дендритные клетки, фагоциты и В-клетки.Эти клетки являются ключевыми для инициирования иммунных ответов. В наших результатах MHC II положительно экспрессировался вокруг эллипсоида и красной пульпы, которые представляют собой связанные с эллипсоидом клетки и макрофаги в красной пульпе (рис. 4). MHC II-позитивные клетки формируются по мере развития селезенки. Распределение MHC II-позитивных клеток увеличивалось с 14 дней до зрелого возраста, на 60 день.

    3.5. Экспрессия мРНК TLR2 и TLR4 в селезенках цыплят разного возраста

    Чтобы подтвердить роль TLR2 и TLR4 в развитии селезенки цыплят, для определения уровней экспрессии мРНК TLR2 и TLR4 в селезенки кур разного возраста (рис. 5).Результаты показали, что экспрессия TLR варьировала в разном возрасте после вылупления. Уровни экспрессии TLR2 и TLR4 увеличивались относительно от 1 дня до 14 дней. Через 14 дней экспрессия мРНК TLR2 и TLR4 в селезенке цыплят была значительно снижена (, , и ). Напротив, в период от 21 до 60 дней не было явных изменений уровней мРНК TLR2 и TLR4.

    3.6. Экспрессия мРНК IL-2, IFN-
    γ и TNF- α во время развития куриной селезенки

    Для дальнейшего изучения экспрессии цитокинов во время развития селезенки мы обнаружили IL-2, IFN- γ и Экспрессия мРНК TNF- α в селезенке цыплят разного возраста с использованием количественной ПЦР (рис. 6).Результаты показали, что экспрессия цитокинов в определенной степени регулярно варьировала в разном возрасте. Уровни мРНК IL-2 и TNF- α повышались через 7 дней, в то время как более низкие уровни обнаруживались по мере увеличения возраста. Экспрессия мРНК IFN- γ была выше в период от 1 до 14 дней, но ниже в период от 21 до 60 дней (1). В совокупности мРНК IL-2, IFN- γ и TNF- α были выше в селезенке цыплят в течение двух недель после вылупления, а затем постепенно снижались, пока они не стабилизировались во взрослом состоянии.

    4. Обсуждение

    Существует ограниченное количество исследований BSB у млекопитающих, включая структуру и функцию барьера цыплят во время постэмбрионального развития. Mast и Goddeeris сообщили, что периартериолярная лимфоидная оболочка (PALS) и селезеночные эллипсоиды начинают формироваться на 20-й день эмбриональной стадии, в то время как периэллипсоидная лимфоидная оболочка (PELS) созревает в течение первой недели после вылупления в селезёнках цыплят-бройлеров [3]. . Zhang и Yang сообщили, что PALS и PELS формируются через 4 дня после вылупления, а зародышевый центр с отчетливой морфологической структурой наблюдается через 14 дней [19].В предыдущем исследовании сообщалось о расположении и структуре BSB у кур [11], но иммунная функция и способ, которым иммунологический барьер сопротивляется антигенам во время развития селезенки, оставались неопределенными.

    В этом исследовании исследовали устойчивость экзогенного антигена BSB к углеродному антигену. Результаты показали расположение частиц углерода в селезенке цыплят разного возраста. Частицы углерода были частично ограничены вокруг эллипсоида, в основном рассеяны в красной пульпе, что предполагает слабый физический барьер через день после вылупления.С возрастом резистентность увеличивается, что может быть связано с морфологическим и структурным развитием селезенки цыплят.

    Что касается этой морфологической характеристики, было обнаружено, что PELS сначала развивается без наличия узлов в селезенке или PALS. Вокруг PELS было меньше лимфоцитов и площадь капиллярной оболочки была ограничена. Электронная микроскопия показала, что внутриклеточное пространство соседних эндотелиальных клеток было неплотным; просвет был узким, а базальная мембрана, выстилающая эндотелиальные клетки, не была четко видна через 7 дней после вылупления.Неспособность куриной селезенки сопротивляться углеродным частицам на начальном этапе была обусловлена ​​неполным развитием архитектуры селезенки, в частности эллипсоидной структуры и оболочки капилляров. По мере взросления цыплят базальная мембрана утолщалась. Площадь лимфоидной ткани PELS и PALS постепенно увеличивалась, а лимфоциты и антигенпрезентирующие клетки распределялись в белой пульпе по мере развития селезенки, что свидетельствует о повышении резистентности БСБ.

    Сообщалось, что иммуноциты и иммунные компоненты были обнаружены у эмбриона на 21 день [20]. В процессе эмбрионального развития Т- и В-клетки-предшественники мигрировали из тимуса и фабрициевой сумки в периферические лимфоидные органы — селезенку и лимфатический узел [21, 22]. По мере развития Т- и В-клеток в лимфоидном органе иммунный механизм птиц постепенно улучшается. CD3 и Bu-1 являются маркерами Т- и В-клеток. Молекулы CD3 и TCR составляют комплекс TCR, который индуцирует сигнал активации в Т-клетках.Bu-1 экспрессируется на куриных В-клетках на протяжении большей части развития этих клеток [23, 24]. Результаты иммуногистохимии распределения CD3 и Bu-1 показывают развитие Т- и В-клеток в куриной селезенке. Количество клеток CD3 + Т и Bu-1 + В в селезенке цыплят возрастало с 1 сут до 60 сут, хотя это увеличение не было линейным. Распределение Т-клеток CD3 + в течение первых 7 дней после вылупления было больше, чем в первые сутки после рождения. Однако это показало нисходящий тренд за 14 дней.Напротив, положительных Bu-1 В-клеток через 21 день было меньше, чем через 14 и 35 дней. В целом распределение Т- и В-клеток увеличивалось между вылуплением и взрослением. MHC II представляет собой класс молекул главного комплекса гистосовместимости, который экспрессируется на антигенпрезентирующих клетках. MHC II-положительные клетки, экспрессируемые вокруг эллипсоида, могут сначала захватывать, а затем представлять антигены из крови, обеспечивая клеточную основу для врожденной иммунной функции BSB.

    TLR экспрессируются в тканеспецифичных неиммунных клетках, включая пищеварительный тракт, дыхательные и репродуктивные пути [25–27], что позволяет предположить, что это первый барьер врожденной иммунологической защиты.Появляется все больше информации о куриных TLR. В нескольких исследованиях лиганды TLR изучались в качестве терапии для обеспечения защитного иммунитета от различных инфекционных заболеваний у кур [28–30]. Однако в таких исследованиях не описана экспрессия TLR в селезенке цыплят после вылупления в типичном состоянии. Чтобы выяснить, регулируют ли TLR поддержание иммунной функции BSB у цыплят, мы определили уровни экспрессии генов TLR2 и TLR4 в селезенке цыплят разного возраста в постэмбриональном развитии.Наши результаты показали, что экспрессия мРНК TLR2 и TLR4 была выше в течение двух недель после вылупления, но снижалась и оставалась относительно стабильной с 21 по 60 день. Хотя эта тенденция может не соответствовать развитию селезенки цыпленка, эти различные экспрессии TLR2 и TLR4 тесно связаны с иммунной функцией селезенки цыпленка.

    Последующие сигнальные пути TLRs через активацию факторов транскрипции приводят к экспрессии нескольких иммунных генов, включая цитокины, хемокины, молекулы адгезии и рецепторы [31].Продукция цитокинов играет ключевую роль на ранней стадии иммунного ответа, опосредуя эффекты врожденного и адаптивного иммунитета. IFN- γ , TNF- α и IL-2 представляют собой плейотропные цитокины, которые используются во время провоспалительной реакции. IFN- γ и IL-2 представляют собой факторы пролиферации Т-клеток, которые высвобождаются из клеток Th2, и являются важными цитокинами для размножения активированных Т-клеток. TNF- α , продуцируемый лейкоцитами и эндотелиальными клетками, участвует в инфекциях, вызываемых бактериями, вирусами и паразитами.Кроме того, TNF- α также регулирует воспалительную реакцию и апоптоз опухолевых клеток [14, 32]. Эти цитокины в иммунном органе показали иммунную функцию селезенки цыплят во время развития.

    Затем мы исследовали уровни экспрессии мРНК IL-2, IFN- γ и TNF- α в селезенке цыплят разного возраста. Мы обнаружили, что уровень мРНК IL-2, IFN- γ и TNF- α был выше в течение двух недель после вылупления, а затем постепенно снижался до стабильного уровня до взрослой жизни.Гу и Ли сообщили, что экспрессия гена IFN- γ совпадает с развитием куриной селезенки и миграцией лимфоцитов [33]. Однако наши результаты иммуногистохимии показали, что количество CD3 и Bu-1-позитивных клеток увеличивалось с возрастом, что, по-видимому, не согласуется с экспрессией цитокинов во время развития. В сочетании с архитектурой и иммунной функцией селезенки цыпленка кажется разумным предположить, что барьерная функция была незрелой сразу после вылупления, и что это приводит к повышенному уровню клеточного иммунитета, в то время как активация мигрирующих Т- и В-клеток к периферическим лимфоидным органам от вылупляющегося эмбриона может быть связано с повышением уровня цитокинов сразу после вылупления.По мере развития куриной селезенки барьерная функция улучшалась, и лимфоциты, макрофаги и антигенпрезентирующие клетки вокруг селезеночного эллипсоида приобретали способность мгновенно захватывать антигены. В совокупности гистологические характеристики куриной селезенки, особенно архитектура BSB, обеспечивают структурную основу для иммунной функции, которая сопротивляется экзогенному антигену. Как важный периферический иммунный орган, селезенка склонна повышать иммунологические уровни, регулируя активность иммуноцитов и иммунную защиту.Строгое поддержание и регулирование иммунной функции селезенки у кур является важной особенностью иммунологии птиц. Дальнейшее изучение онтогенеза и функции иммунологического барьера может внести существенный вклад в наше понимание механизмов иммунологии птиц, а также предоставить более совершенные средства для изучения роли куриной селезенки в воспалении и иммунологических реакциях при инфекционных заболеваниях.

    5. Заключение

    Наши результаты показывают, что BSB развился с морфологической архитектурой, которая устойчива к корпускулярному антигену, распределению иммуноцитов, TLR2/4 и экспрессии цитокинов в постэмбриональной селезенке цыпленка и которая обеспечивает структурную основу для селезенки селезенки. иммунной функции, а также лучшее понимание иммунологии птиц и патогенеза инфекционных заболеваний.

    Доступность данных

    Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

    Конфликт интересов

    Авторы заявляют об отсутствии конкурирующих интересов.

    Благодарности

    Это исследование было поддержано Национальным фондом естественных наук Китая (31700793 — Q. Zhang; 31672505 — Q. Chen) и Приоритетной академической программой развития высших учебных заведений Цзянсу, Китай.

    Постэмбриональные изменения гистологии яичников и связанные с ними профили 17β-эстрадиола и прогестерона у цесарок (Numida meleagris)

    Резюме

    Информации о репродуктивной биологии цесарок недостаточно. Исследование было проведено для документирования постэмбриональных изменений гистологии яичников и связанных с ними профилей прогестерона и 17β-эстрадиола до возраста 32 недель (WOA). Очень значительное увеличение ( P  < 0.001) были обнаружены в диаметрах ооцитов и фолликулов более 16 WOA. Другие фолликулярные морфометрические признаки яичников показали непостоянное увеличение до 16 WOA. Первая фаза отложения желтка произошла между вылуплением и 20 WOA, вторая фаза — между 20 и 26 WOA, а третья и последняя фаза — между 27 и 28 WOA. Периферические концентрации 17β-эстрадиола увеличивались с 20 WOA до пика 28 WOA, тогда как периферические концентрации прогестерона значительно колебались во время полового развития.Концентрации эстрадиола и прогестерона отрицательно и умеренно коррелировали ( P  < 0,01) с диаметром ядер ооцитов, высотой гранулезного и тека-слоя. Однако концентрации эстрадиола положительно и сильно коррелировали ( P  < 0,001) с диаметром ооцитов и фолликулов и умеренно с концентрацией прогестерона. У цесарок были обнаружены три фазы отложения желтка, причем последняя фаза заканчивалась на 28 WOA при гораздо меньшем диаметре ооцитов, чем у домашней курицы.Эстрадиол может играть роль в отложении желтка у этого вида.

    Резюме

    Il y a une pénurie d’information au sujet de la biologie de воспроизводства пинтадов. Une etude a été effectuée afin de documenter les postembryonnaires développementaux post-embryonnaires dans l’histologie ovarienne et les profils associés de progestérone et de 17β-stradiol jusqu’à 32 semaines d’age (WOA — «недели возраста»). Des augmentations fortement significatives ( P  < 0,001) ont été note dans les d’ovocytes et folliculaires après 16 WOA.D'autres caractéristiques morphometriques ovariennes et folliculaires ont montré des augmentations inconstantes jusqu'à 16 WOA. Первая фаза депо де желтка s’effectue entre l’éclosion et 20 WOA, вторая фаза entre 20 и 26 WOA, et la troisieme et dernière фаза entre 27 и 28 WOA. Периферийные концентрации 17β-эстрадиола увеличиваются на части 20 WOA, если она соответствует 28 WOA, и периферические концентрации прогестерона колеблются в зависимости от фактора, важного для развития сексуальной функции.

    0 comments on “Схема постэмбрионального развития: Урок 12. постэмбриональное развитие организма. определение пола. саморегуляция и гомеостаз. стволовые клетки — Биология — 10 класс

    Добавить комментарий

    Ваш адрес email не будет опубликован.